ID: 1012637212

View in Genome Browser
Species Human (GRCh38)
Location 6:101558985-101559007
Sequence CTTGGTAACCAAAAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 247}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012637212 Original CRISPR CTTGGTAACCAAAAGGAAGG TGG (reversed) Intronic
900983493 1:6059803-6059825 CCTGGTGAGCAAGAGGAAGGAGG + Intronic
901172732 1:7273383-7273405 CTTGGCAATAAAAAGGAATGAGG + Intronic
902091683 1:13908696-13908718 CTTGGTAAACTAAAGCATGGTGG + Intergenic
902708333 1:18221849-18221871 AGTTGTACCCAAAAGGAAGGTGG + Intronic
903814994 1:26058381-26058403 CCTGCTCACCAAGAGGAAGGTGG + Exonic
908815470 1:68028446-68028468 CTGGGTAACATAAAGGAAAGAGG + Intergenic
912152708 1:106879828-106879850 CTCCTTAAGCAAAAGGAAGGAGG - Intergenic
912819584 1:112856100-112856122 CTTGGTAACCAAAATGTGTGTGG - Intergenic
914222316 1:145692121-145692143 CTTGGTAATGAAAAGGAGGGTGG + Intronic
915566602 1:156717316-156717338 GCTGGCAACCAAAAGGAAGCTGG - Intergenic
918211445 1:182354770-182354792 GTTGGGAACCAAAAGGATGAGGG + Intergenic
918326496 1:183416346-183416368 CTTTGGAACCAAGAGAAAGGAGG - Intronic
918984502 1:191606836-191606858 CTAGGTGACCAAAAATAAGGAGG - Intergenic
921027744 1:211303264-211303286 CTTTCTCACCAAAAGTAAGGAGG - Intronic
921965345 1:221082302-221082324 CTTGATAAACAATAAGAAGGTGG - Intergenic
923723273 1:236485193-236485215 CTGGGTAACCAAAAGGGATTTGG - Intergenic
924406148 1:243749038-243749060 AGTGGTAAGGAAAAGGAAGGAGG - Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1062790159 10:298570-298592 CTTGGTCACCCAGAGGCAGGAGG - Intronic
1063691652 10:8293182-8293204 CATGATACCCAAAAGTAAGGTGG - Intergenic
1063922550 10:10946555-10946577 GTTGGAAATCAAAAGGTAGGGGG + Intergenic
1065145894 10:22767811-22767833 TTGGGTCACCAAAAGGAAGATGG - Intergenic
1066441722 10:35445679-35445701 TTTGGAAACCAGAGGGAAGGAGG + Intronic
1067293947 10:44963654-44963676 CCTGGGAAGCAAAAGAAAGGAGG - Intronic
1067422640 10:46168934-46168956 AATGGTAACCAAAAGAGAGGTGG - Intergenic
1068021494 10:51590926-51590948 ATTGGTAAGCACAAGGAATGTGG + Intronic
1068347703 10:55804309-55804331 AATGGTAACCAAAAGAGAGGTGG + Intergenic
1068408254 10:56622064-56622086 CTTCATAGCCAAAAGGAAAGTGG + Intergenic
1068898741 10:62240126-62240148 CTTGGAAACCAAAATGACAGCGG - Intronic
1069313414 10:67067893-67067915 ATTGGCAACACAAAGGAAGGAGG + Intronic
1069572365 10:69502067-69502089 CCTGGCAACCAAAAGGAAAAGGG + Intronic
1069869377 10:71523912-71523934 CTTGGGGACCACAAAGAAGGTGG - Intronic
1070860106 10:79648725-79648747 AATGGTAACCAAAAGAGAGGTGG - Intergenic
1072850055 10:98880617-98880639 CTTGATAATCAAAAGGAAGCAGG - Intronic
1074260848 10:111851909-111851931 CCTGGTAACCAAATGGAACATGG - Intergenic
1075030560 10:119021915-119021937 CTTAGTGACCAGAAGGCAGGTGG - Intergenic
1075601398 10:123772164-123772186 GGTGGTAACCACAACGAAGGAGG - Intronic
1075934435 10:126327357-126327379 CATGGGAACCTAAAGAAAGGGGG - Intronic
1078135725 11:8650065-8650087 CTTTGTAACCAAAAGAACAGTGG + Intronic
1078497393 11:11832881-11832903 CTTGGTAAACATATTGAAGGAGG - Intergenic
1078525635 11:12098968-12098990 CTTGGGAATGAAAAGGCAGGAGG + Intronic
1078759667 11:14242173-14242195 CATGGAAACTGAAAGGAAGGAGG - Intronic
1081237350 11:40660932-40660954 ATTGCTAACCATAAGGAAGAGGG + Intronic
1082920839 11:58492069-58492091 GTTGGTGATCAAAAGGCAGGAGG - Intergenic
1085229201 11:74949987-74950009 CTTGGTAGCAAAGAGGGAGGTGG - Intronic
1085548015 11:77338730-77338752 CTTGGCAATAAAAAGGAATGAGG + Intronic
1086150074 11:83599369-83599391 CTGGATAAGCAAAAGCAAGGAGG - Intronic
1088329232 11:108633178-108633200 CATGGTAACAAGAAAGAAGGTGG - Intergenic
1090723903 11:129504450-129504472 CTTTGTAACCAAAAGGTGGTAGG - Intergenic
1091072005 11:132575073-132575095 AATGGTAACCAAAAGAAAGCAGG - Intronic
1091491709 12:938095-938117 CTTGGGAATAAAAAGGAGGGCGG + Intronic
1091993479 12:4974681-4974703 CTGGGAATCCAAAATGAAGGAGG - Intergenic
1092264291 12:6969462-6969484 CTTGGTAATCACATGGCAGGTGG - Intronic
1093414786 12:18907677-18907699 TTTGGCAACCATAAGGAGGGTGG + Intergenic
1093755796 12:22850624-22850646 CCTGGTGCCCAAAAGGAATGAGG + Intergenic
1094749922 12:33394161-33394183 CATGGTAAGTAAAAGGAAGCTGG - Intronic
1094776651 12:33737269-33737291 CTTGGTCACAGAAAGGAACGAGG + Intergenic
1094799225 12:34011675-34011697 CTAGGTAGCCAAAATGAATGTGG - Intergenic
1095112005 12:38305949-38305971 CTAGGTAGCCAAAATGAATGTGG - Intergenic
1098219009 12:68248700-68248722 TTTTTTAACCAAAAGGAAGATGG - Exonic
1099234036 12:80060951-80060973 CTTGGAAAGCAAAATGAATGCGG + Intergenic
1099601997 12:84751455-84751477 CTTGTTAACCCTAAGGAAGGTGG - Intergenic
1100243643 12:92734815-92734837 CTTAGTAACTAAGAGGTAGGTGG - Intronic
1100657457 12:96661998-96662020 CTTGGTAACCAGTTGGAAGTGGG - Intronic
1102368082 12:112356731-112356753 CTTGGTTAAGAAAAGGAAAGGGG - Intronic
1104400413 12:128471449-128471471 CTTCTGAACCAAATGGAAGGAGG + Intronic
1104776798 12:131394163-131394185 CTTGATTTTCAAAAGGAAGGTGG - Intergenic
1106405824 13:29471922-29471944 CCTGGTGACCAAAAGGGAGCTGG - Intronic
1108036936 13:46299975-46299997 AATGGAAACCAAAAGCAAGGAGG + Intergenic
1108489654 13:50968541-50968563 TTGGGTAAACAAAAGGAACGAGG - Intronic
1112119010 13:96388916-96388938 CTGGGTAACTTAAAGGAAAGAGG - Intronic
1112586756 13:100725444-100725466 GTTCATAACCAAAAGAAAGGAGG + Intergenic
1113393500 13:109920642-109920664 CCTGGGCACCAAAAGAAAGGGGG - Intergenic
1114402246 14:22420693-22420715 ATGGGAAACCAAAAAGAAGGTGG + Intergenic
1114572132 14:23678709-23678731 ATTGTTAACCAAAAGAAAGCTGG + Intergenic
1118712337 14:68531426-68531448 AATGCTAACCAAAAGAAAGGTGG + Intronic
1119184730 14:72632042-72632064 CTTGATGAGCAAAAGGAAAGGGG + Intronic
1120175680 14:81290813-81290835 CTTGGTAACTAAAAGAGAGTTGG - Intronic
1120322551 14:82983410-82983432 ATTGGTAGATAAAAGGAAGGAGG - Intergenic
1122431552 14:101651728-101651750 GTTGCTAACCAAAAGGAAACTGG + Intergenic
1123819040 15:24008255-24008277 TTTGGGAAACAAAAGGAAGGTGG + Intergenic
1124700750 15:31909886-31909908 CTGGGTACCCAGAAGGCAGGGGG + Intergenic
1124710598 15:32006847-32006869 CTTGGTAGGCAAACAGAAGGTGG - Intergenic
1127760893 15:62138087-62138109 CTAGGTCACCTCAAGGAAGGAGG - Intergenic
1128005954 15:64241192-64241214 AATGGAAACCAAAAGCAAGGAGG + Intronic
1128637473 15:69312425-69312447 TGTGGTAACCAAAAGGTAGCAGG - Intronic
1129206507 15:74040369-74040391 CTTGGAAGAGAAAAGGAAGGGGG - Intronic
1130239015 15:82168128-82168150 TTTGGTATCCAAATGCAAGGGGG - Intronic
1130894573 15:88160170-88160192 CTGGGGAACCCAGAGGAAGGAGG + Intronic
1132595588 16:747777-747799 CGTGGTACCCAACAGGAATGTGG + Intronic
1135690651 16:24534761-24534783 CTTTGTCAGCAACAGGAAGGAGG + Intergenic
1137366445 16:47863585-47863607 CTTGGAAATGAAAAGGTAGGTGG + Intergenic
1137938831 16:52661196-52661218 CATGGAAACCAAAAGCAAGCAGG + Intergenic
1137973462 16:53009260-53009282 ATTGGAAACCAAAAGGGAGTAGG - Intergenic
1140706494 16:77635317-77635339 CTTGGTAAAGAAGAGAAAGGGGG - Intergenic
1140921482 16:79542526-79542548 CTTGGATAACAAAAGGAAGCAGG + Intergenic
1142750175 17:1982798-1982820 CTTGCTGACCCAGAGGAAGGAGG + Intronic
1142864109 17:2779920-2779942 GGTGGTAACCAAATGGGAGGGGG + Intronic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1144535435 17:16084428-16084450 CTTGGGAACCAAAAAAAGGGGGG + Intronic
1145835372 17:27950747-27950769 GTTGGTACCCTAATGGAAGGAGG - Intergenic
1146156729 17:30530521-30530543 TTTGGGAGCCAAAAGGCAGGAGG - Intergenic
1150796777 17:68245016-68245038 GTTGGTAACAAATTGGAAGGTGG - Intergenic
1151270991 17:72995906-72995928 CTTGGTAACCAATTGGATGTGGG - Intronic
1151844054 17:76638916-76638938 CTTGGCAACAAATAGGATGGTGG - Intronic
1152199701 17:78938191-78938213 CTTGGGAACCAGTAGCAAGGGGG + Intergenic
1155863878 18:30940038-30940060 AATGGTAACCAAAAGAAAGTGGG - Intergenic
1156986567 18:43357146-43357168 CTTGTTAACCAATAGGACAGAGG - Intergenic
1157210940 18:45741331-45741353 CTTGGGAACAAAAAGGAGGAGGG + Intronic
1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG + Intergenic
1157642461 18:49231627-49231649 CCTAATAACCAAAAGGAATGTGG - Intronic
1158150755 18:54366979-54367001 AGTGGTAACCAAAAGGAAGTAGG - Intronic
1158398375 18:57097710-57097732 CTAGGTAACAAGAAGGGAGGAGG + Intergenic
1158854569 18:61530130-61530152 CTTTGTAACCAAAATGCAGAGGG - Intronic
1162748032 19:12810265-12810287 CATGGCCACCAAAGGGAAGGAGG + Intronic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1164946735 19:32301141-32301163 AATGGTAACCAAAAGAAAGCAGG - Intergenic
1165527591 19:36369142-36369164 CTTGGATACTAAAAGGAAAGTGG - Intronic
1167403159 19:49286461-49286483 CCTGGTTCCCAAAAGGGAGGAGG + Intergenic
925843476 2:8013711-8013733 CTTGATCATTAAAAGGAAGGTGG + Intergenic
928421016 2:31137993-31138015 CTGGGTAACCAAGAGGAAGTTGG - Exonic
931542225 2:63341853-63341875 AGTGGTAACCAAAAGAGAGGTGG - Intronic
932344413 2:70986197-70986219 CTCTGTGACCAAAAGAAAGGAGG + Exonic
932961808 2:76421159-76421181 CATGAAAACCAAAAGGAAAGGGG - Intergenic
932967416 2:76492826-76492848 TTTTGTTACCAAAAGGAAGTAGG + Intergenic
933444977 2:82368392-82368414 ATTGGTAACCACGGGGAAGGGGG - Intergenic
936607988 2:113976685-113976707 CTCCCTAACCAAAAGGAAGTTGG - Intergenic
936892380 2:117387561-117387583 CATGGAAACCAAAAGCAAGTGGG - Intergenic
938215450 2:129509053-129509075 CTTAATAACCAAAGGCAAGGTGG + Intergenic
940198462 2:151123076-151123098 CTTTGTCTCCAAAAGAAAGGGGG + Intergenic
944360305 2:198846958-198846980 CTTGCTAACCAGAAGGGAAGAGG + Intergenic
944432726 2:199652034-199652056 AATGGTAACCAAAAGAAAGCAGG - Intergenic
946553771 2:220832206-220832228 CATGATAACTAAAAGAAAGGAGG - Intergenic
947083049 2:226420121-226420143 CTTGATCACCAAGAGGAAGTAGG - Intergenic
948169256 2:235888070-235888092 CATGATAAGCAAATGGAAGGAGG - Intronic
1169851674 20:10059101-10059123 CTTGATAAGCAAAGGGGAGGGGG - Intergenic
1170873452 20:20229573-20229595 CTGGGTAAGCAAATGGATGGAGG + Intronic
1173074176 20:39800954-39800976 CTGGAGAACCAAAAGGAAGCAGG - Intergenic
1175142537 20:56871824-56871846 ATGGGTGATCAAAAGGAAGGCGG - Intergenic
1175577031 20:60067810-60067832 CTTGGGAGCCCATAGGAAGGAGG - Intronic
1177083347 21:16670016-16670038 CTTGGCAACCAAATGCAATGTGG + Intergenic
1180012653 21:45061228-45061250 CTTGGGAACCCAGAGGCAGGGGG - Intergenic
1180164529 21:46017110-46017132 ATTGATACCCAAGAGGAAGGGGG + Intergenic
1181537470 22:23554002-23554024 CTTGGAAGGGAAAAGGAAGGTGG - Intergenic
1181827767 22:25532948-25532970 CTTGTTAATCAGAAGAAAGGAGG + Intergenic
1182720538 22:32395025-32395047 CTTGGTAATCAACAGCAATGAGG + Exonic
1182836910 22:33349642-33349664 ATTGGAAAGGAAAAGGAAGGGGG - Intronic
1183528822 22:38341118-38341140 CTCGGTGACGAAAAGGAAGGAGG - Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184892102 22:47386349-47386371 CGTGGGGACCAGAAGGAAGGGGG + Intergenic
1184892332 22:47387607-47387629 CGTGGGGACCAGAAGGAAGGGGG + Intergenic
949878527 3:8643035-8643057 CTTGCTCACCAAAAGGCATGAGG + Intronic
951587239 3:24227841-24227863 CATGGTAACAAAAAGGACAGTGG + Intronic
951607492 3:24452304-24452326 CTTGGGCACCAAACGGAAGGGGG - Intronic
951685293 3:25337189-25337211 GTTGGTAAGAAAAAGGATGGTGG - Intronic
952033382 3:29171548-29171570 CATGGCATTCAAAAGGAAGGAGG - Intergenic
952865481 3:37852586-37852608 CTTGGTAAGAGAAAAGAAGGAGG - Intergenic
954156988 3:48691002-48691024 CTAGGTAACCTAGAGGAAGAGGG - Intronic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
955117788 3:56023192-56023214 CATGGAGACCAAATGGAAGGAGG - Intronic
957124179 3:76136395-76136417 GTTGGTAACAAAAATGAATGGGG + Intronic
957827671 3:85469570-85469592 CTTTGTAAGCAAGAGAAAGGGGG + Intronic
961235848 3:125366301-125366323 CTTGGTAAGCAAACAGAAGCTGG - Intronic
961639268 3:128354757-128354779 TTTTATAACCAAAAGAAAGGAGG + Intronic
962433591 3:135344474-135344496 CTTGGTTGCCAGATGGAAGGGGG - Intergenic
963263535 3:143216530-143216552 CTCAGGAGCCAAAAGGAAGGTGG - Intergenic
965082889 3:164057681-164057703 AATAGTAACCAAAAGAAAGGAGG - Intergenic
965203110 3:165686222-165686244 TCTGGGAACCAAATGGAAGGGGG + Intergenic
966275621 3:178163259-178163281 TTTGGTAACCAAGATGAAGTGGG + Intergenic
966499559 3:180624240-180624262 CATGGAAACCAAAAGCAAGTAGG - Intronic
967596656 3:191332783-191332805 CTTGGAGAGCAAAAGGAAGTAGG - Intronic
969272593 4:6112989-6113011 CTTGGGATCCTGAAGGAAGGAGG + Exonic
971176654 4:24288853-24288875 ATTGGTAACTAAAAAGAGGGAGG - Intergenic
972292409 4:37701913-37701935 ATGGGTAACCAAAAGGTTGGTGG - Intergenic
973006329 4:45011172-45011194 TTTGGTTTCCAAAAGGAAGTTGG + Intergenic
978357422 4:107891845-107891867 CATGGTGACAAAAAGGAAGATGG + Intronic
978385416 4:108172239-108172261 GGTGGGATCCAAAAGGAAGGAGG + Intergenic
979741440 4:124155724-124155746 CTTGGACACCAAAAGTAATGGGG - Intergenic
979816369 4:125111029-125111051 CTTGGAACTCCAAAGGAAGGAGG - Intergenic
980581016 4:134750382-134750404 CATTATAACCAAAAGAAAGGAGG + Intergenic
981939291 4:150264794-150264816 ATTGCTAATCAAAAGGAAGGTGG + Exonic
982532321 4:156560553-156560575 AATGGTAACCAAAAGAAAGCAGG - Intergenic
982677133 4:158388745-158388767 CTTGGTACCCAACACAAAGGAGG - Intronic
983747200 4:171216458-171216480 ATTGGAAAAAAAAAGGAAGGTGG - Intergenic
984843052 4:184086173-184086195 CTTGCTAGAAAAAAGGAAGGAGG - Intergenic
987452151 5:18098894-18098916 CTTGGTAACTAAAAGGAGCCTGG + Intergenic
989664923 5:43842735-43842757 CATGATAACCAAAGGGAAGAGGG + Intergenic
991201063 5:63993386-63993408 CTTGATAACTAAATGGAATGTGG - Intergenic
992846618 5:80755725-80755747 CTTGGTAATCAAAAGGATTGGGG + Intronic
994502328 5:100595388-100595410 CTTTGTTTGCAAAAGGAAGGAGG + Intergenic
996667931 5:126082257-126082279 ATTGGTAACCAAAAGAGAGCAGG + Intergenic
996696321 5:126399793-126399815 AATGGTAACCAAAAGAAAGCAGG - Intronic
996993301 5:129663569-129663591 CTTAGTAACCAAAAGAAAGTGGG - Intronic
997190308 5:131927776-131927798 AATGGTAACCAAAAGAGAGGAGG - Intronic
1000800762 5:165723317-165723339 CTTGTTAACCAAATGAAATGTGG - Intergenic
1001370844 5:171199287-171199309 CTTGGCACCCAAAGAGAAGGGGG + Intronic
1001696609 5:173674928-173674950 CCTGCTAGCCAGAAGGAAGGGGG - Intergenic
1003360983 6:5424995-5425017 CGTGGAAAGAAAAAGGAAGGAGG - Intronic
1003831169 6:10013371-10013393 CTTGATAACCAACAGGACGCAGG + Intronic
1004973470 6:20937541-20937563 CTTGGTAACCACATGTAATGTGG - Intronic
1005526708 6:26658579-26658601 TTTTGAAACCAAAAGGAAGATGG - Exonic
1006685044 6:35825730-35825752 CTTGGGAAGCTAAAGGCAGGAGG - Intronic
1007640405 6:43334604-43334626 CCCACTAACCAAAAGGAAGGAGG + Intronic
1007873908 6:45072756-45072778 CTTGGTAACACAAAGAAAGATGG - Intronic
1008828620 6:55730666-55730688 CCTGGAAACCAAAAAGTAGGTGG - Intergenic
1011492178 6:87903476-87903498 CATGGAAACCAAAGGGAAGGTGG - Intergenic
1011662008 6:89602875-89602897 CTTGGTTACCACAGGCAAGGCGG - Intronic
1012637212 6:101558985-101559007 CTTGGTAACCAAAAGGAAGGTGG - Intronic
1012670877 6:102046021-102046043 CATGGTAACCAAAAGTCAGCAGG + Intronic
1013017241 6:106170999-106171021 CTCAGAAAACAAAAGGAAGGGGG + Intergenic
1014100239 6:117503745-117503767 CCTGGTAAAGAAAAAGAAGGGGG - Exonic
1014230765 6:118899403-118899425 CTTGGCAAGAAAAAGCAAGGAGG - Intronic
1015816077 6:137212208-137212230 CTTGGAAACCTAGAGGAAGGGGG - Intronic
1015958366 6:138621754-138621776 CATGCAAACCAAAAGTAAGGGGG + Intronic
1016718731 6:147267345-147267367 CTAGATAACCAAATGGCAGGTGG - Intronic
1018222577 6:161595802-161595824 CTTATCAGCCAAAAGGAAGGAGG + Intronic
1019489457 7:1305129-1305151 ATTGGTACCCAGAATGAAGGAGG + Intergenic
1019789848 7:3004114-3004136 CATGGTAACCAGCAGGAAGCTGG - Intronic
1019862603 7:3674304-3674326 CATGGTAATGAGAAGGAAGGAGG + Intronic
1022834148 7:34097740-34097762 CTTGGTGACCCAAAGGAATCTGG - Intronic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1025245437 7:57313197-57313219 TTTGGGAACCAGAAGGAAGCGGG - Intergenic
1025620915 7:63169986-63170008 TATGGTAGCCAAAAGGAATGAGG + Intergenic
1028980608 7:96963957-96963979 TTTGGAAACAAAAAGGAAGTTGG - Intergenic
1028985491 7:97005726-97005748 CTTGTTAACTCAAAGGGAGGAGG - Exonic
1030594414 7:111519945-111519967 CTTGGGACCAAAAAGGAATGTGG + Intronic
1030710302 7:112741116-112741138 CTTGGTAAATAAAATGAAGATGG - Intergenic
1030776521 7:113539778-113539800 CATGGTAACCAAAAGAGAGAAGG + Intergenic
1031390948 7:121213958-121213980 CATGATAACCAAAAGTAATGTGG - Intronic
1031878799 7:127172800-127172822 TTTTGTCACCTAAAGGAAGGAGG + Intronic
1033603948 7:142911439-142911461 CTAGGTAGTTAAAAGGAAGGAGG - Intronic
1034151956 7:148924059-148924081 CATGGTAACCTATAGGAAGAAGG - Intergenic
1034377575 7:150659499-150659521 CTTGGTTCCCAAAGGGAAAGGGG - Intergenic
1035403512 7:158584200-158584222 CTTCTTTAGCAAAAGGAAGGGGG + Intronic
1035934653 8:3822981-3823003 CTTCGTAACCAAAGGGAACCTGG - Intronic
1037227348 8:16608937-16608959 ATTGGAAACAAAAAGAAAGGTGG + Intergenic
1037303197 8:17475680-17475702 ATTGGTAACCAAAATAAAGCAGG - Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1037904897 8:22710526-22710548 CCTGGAAACCACAGGGAAGGAGG - Intergenic
1039554231 8:38465652-38465674 CTCGGTCACCGAGAGGAAGGTGG + Intronic
1040845456 8:51833224-51833246 CTGGGTAAGCAAAACAAAGGAGG + Intronic
1043150561 8:76709690-76709712 TGTGGGAACCTAAAGGAAGGTGG + Intronic
1045860575 8:106811446-106811468 CATGGTTACCAAAGGGAAGAAGG + Intergenic
1048604423 8:135952842-135952864 CTTGGTACCCAGAAAGAAGGAGG - Intergenic
1048608548 8:135996497-135996519 CAAGGTAACCACAATGAAGGAGG + Intergenic
1048649550 8:136459845-136459867 CATGGAAGCCAAAAGGAAGGGGG + Intergenic
1050704726 9:8384244-8384266 CTGGGCAACCACATGGAAGGAGG - Intronic
1050980933 9:12014693-12014715 CTTGGAGGCCAAAAGGAAGTGGG + Intergenic
1051889506 9:21927830-21927852 ATGGCTAACCAGAAGGAAGGGGG + Intronic
1055398571 9:75899104-75899126 CTTGGTAACTAAATGGAAGTAGG + Intronic
1055767818 9:79683997-79684019 CCTGAGAACCAAAAGGAATGAGG + Intronic
1056736611 9:89215214-89215236 TTCTGTAACAAAAAGGAAGGGGG + Intergenic
1057682242 9:97199778-97199800 TTTTGAAACCAAAAGGAAGATGG - Intergenic
1061654488 9:132078641-132078663 CTTAGTAACCAGATGGAAAGAGG - Intronic
1186418032 X:9400326-9400348 CTTGGAAGCCTAGAGGAAGGTGG - Intergenic
1186424708 X:9454841-9454863 TATGGTTACCAAAAGAAAGGCGG + Intergenic
1186920443 X:14273219-14273241 TTTGGTATTCAAAAGGAAGTTGG + Intergenic
1190518028 X:51244803-51244825 AATGGTAACCAAAAGAAAGCAGG + Intergenic
1190704754 X:53018002-53018024 CTTGGCAATAAAAAGGAATGAGG + Intergenic
1190808589 X:53862483-53862505 CTTGGCAACCAAGAGGAAGCAGG - Intergenic
1191839189 X:65498492-65498514 CTAGGAGACCAAAAGGAAAGGGG + Intronic
1192924901 X:75746101-75746123 CTCGGTTACCATAAAGAAGGTGG + Intergenic
1193696253 X:84710137-84710159 CTTGAAATCCAAAAGGGAGGAGG + Intergenic
1197379655 X:125723976-125723998 CTTGGTAACCTAAATGTAGATGG + Intergenic
1197814708 X:130485246-130485268 CTAGGCAAACAAATGGAAGGTGG - Intergenic
1198830123 X:140741544-140741566 CTTGGACACCAAGATGAAGGAGG + Intergenic
1199170509 X:144729369-144729391 CATGGGAACCAAAAGCAAGCAGG + Intergenic