ID: 1012639760

View in Genome Browser
Species Human (GRCh38)
Location 6:101595045-101595067
Sequence GGTACCGAGAAACCTCAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 49}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012639760 Original CRISPR GGTACCGAGAAACCTCAAGT AGG Intronic
900735618 1:4297809-4297831 GGAACCCAGAGACCTCCAGTGGG + Intergenic
918036132 1:180873925-180873947 CTTACCGGAAAACCTCAAGTGGG - Exonic
1064666651 10:17659578-17659600 GCTACCGAGAAGGCTGAAGTGGG - Intronic
1065419879 10:25531300-25531322 GGAAAAGAGAAACATCAAGTAGG + Intronic
1067100039 10:43328113-43328135 GGTCCCAAGAAGCCTGAAGTCGG - Intergenic
1068852418 10:61759213-61759235 GAAAACGAGAACCCTCAAGTGGG + Intronic
1085251545 11:75147368-75147390 GGTAGGGAGAAACCTCCAGATGG + Intronic
1093646718 12:21594541-21594563 GGAACCGAAAAACCTCTATTCGG + Intronic
1099718377 12:86328567-86328589 AGCACCAAGAAACATCAAGTGGG + Intronic
1104867121 12:131962686-131962708 GGTACTAAGAAATCTCAGGTAGG - Intronic
1110559211 13:76892177-76892199 GGTACCCATAAACCTAAAATAGG - Intergenic
1115628306 14:35217707-35217729 GGTACCAAGATAATTCAAGTAGG - Intronic
1121899876 14:97684291-97684313 GGTATAGAAAAACCACAAGTGGG - Intergenic
1123457408 15:20438776-20438798 GATTCCGAGAACCCTGAAGTGGG - Intergenic
1123660650 15:22561583-22561605 GATTCCGAGAACCCTGAAGTGGG + Intergenic
1134760749 16:16712871-16712893 TCTACCCACAAACCTCAAGTTGG + Intergenic
1134854675 16:17508447-17508469 GATACTGAGAACCCTCAATTAGG - Intergenic
1134985310 16:18646303-18646325 TCTACCCACAAACCTCAAGTTGG - Intergenic
1146106203 17:30039567-30039589 GGTACCAAGATACCCCAAGTTGG + Intronic
1152945543 17:83195674-83195696 GGGACAGGGAAACTTCAAGTGGG + Intergenic
1165743251 19:38216108-38216130 GGCCCCCAGAAACCTCAGGTGGG + Intronic
925270351 2:2601663-2601685 AGTACCGAGAAAGCCCAATTAGG - Intergenic
927368978 2:22332676-22332698 GCTACCCACAAACCTCCAGTGGG + Intergenic
932968355 2:76505613-76505635 GTTACAGAGAAACTTCAAGGAGG - Intergenic
933372318 2:81430710-81430732 GGTAAAAAGAATCCTCAAGTGGG - Intergenic
945962767 2:216152767-216152789 GCTACTGAGGATCCTCAAGTTGG - Intronic
948548304 2:238748626-238748648 GGTACCCAGCAGCCTGAAGTTGG - Intergenic
1172561980 20:35897143-35897165 GCTACCCAGAAAGCTCAGGTGGG - Intronic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
956210707 3:66798682-66798704 GCTACCCAGAAACCTGAAGGTGG + Intergenic
963664107 3:148160353-148160375 GGTACCCACAAACCTTCAGTTGG - Intergenic
964155513 3:153580795-153580817 GGTATCAAGAAACCTGAAGCTGG + Intergenic
967431043 3:189385585-189385607 GGTACCCAGAAACCTGAGGTGGG - Intergenic
968631498 4:1654412-1654434 GGCACTGAGAATCTTCAAGTGGG + Intronic
983803694 4:171967108-171967130 AGTAACGAGAAAACTTAAGTGGG - Intronic
987774049 5:22341645-22341667 GATCCTGAGAAACTTCAAGTAGG + Intronic
1008617467 6:53240462-53240484 GGCAACAAGAAACCCCAAGTGGG + Intergenic
1012639760 6:101595045-101595067 GGTACCGAGAAACCTCAAGTAGG + Intronic
1019167905 6:170110991-170111013 GGTACAGGGGAACTTCAAGTGGG + Intergenic
1020711608 7:11613148-11613170 GATACCCAGAAACCTCAATGTGG - Intronic
1020836301 7:13156093-13156115 GCTACCTAGAAACCTAAAGTAGG - Intergenic
1022727052 7:32990874-32990896 GGATCCAAGAAACGTCAAGTTGG + Intronic
1024841933 7:53596639-53596661 GGGACTGTAAAACCTCAAGTGGG + Intergenic
1025046528 7:55696756-55696778 GGATCCAAGAAACGTCAAGTTGG - Intergenic
1030468641 7:109935460-109935482 GTTACCGAGAAATCCCAAGAAGG + Intergenic
1031270104 7:119637650-119637672 GATACCCAGAAAACACAAGTGGG - Intergenic
1031415763 7:121494995-121495017 TTTACCCAGAAACATCAAGTAGG + Intergenic
1032008755 7:128327023-128327045 GCTACCGAGAAAGCTGAGGTGGG + Intronic
1040621942 8:49101312-49101334 GGTACCAAGATACCCCAAATTGG + Intergenic
1047407123 8:124595019-124595041 GGTACCGAGAACACAGAAGTAGG - Intronic
1050616398 9:7405744-7405766 GGTTGCTAGATACCTCAAGTTGG + Intergenic
1051691274 9:19715384-19715406 GGGACCGAGTATCCTCAAGTAGG + Intronic
1059873981 9:118612363-118612385 GCTCCCGTGAAACCTTAAGTAGG + Intergenic
1187007646 X:15248117-15248139 GGAACAAAGACACCTCAAGTTGG - Intronic