ID: 1012641718

View in Genome Browser
Species Human (GRCh38)
Location 6:101625769-101625791
Sequence CTCAGTCATCTTTATATATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012641718 Original CRISPR CTCAGTCATCTTTATATATT TGG (reversed) Intronic
903847665 1:26288119-26288141 CTCTGTCTTCTTTATAGATGGGG + Intronic
904137780 1:28327423-28327445 CTCTGTCCTCTATATATATATGG - Intergenic
905723400 1:40227522-40227544 TTCAGGCATGTTTATATATTTGG + Intronic
906200147 1:43954660-43954682 CTCAGTCCCCTTTGTATACTGGG + Intronic
906888372 1:49678028-49678050 CTAATTCTTCTTTATATATTTGG + Intronic
906928639 1:50146687-50146709 CTGAATAATCTTTATATAATAGG + Intronic
907037364 1:51228503-51228525 CTCAGTCAGCTGCAGATATTAGG + Intergenic
907720459 1:56967412-56967434 CTCAGTCATTTGTATCTTTTGGG - Intergenic
908005381 1:59722534-59722556 CTCATACATATTTATATTTTTGG + Intronic
910125933 1:83842296-83842318 CTCAGTCTTGTTAATATGTTTGG - Intergenic
910663914 1:89703852-89703874 CTCACTCATATTTGGATATTTGG - Intronic
912477469 1:109948904-109948926 CAGAGTAATCTTTATATATTTGG + Intergenic
912858982 1:113196212-113196234 CTCATTCATATTTATATTTTTGG + Intergenic
913013387 1:114708324-114708346 CACAGGTATCTTTATATTTTTGG - Intronic
915740512 1:158115284-158115306 CTCAGTCATCTGTATGTAAATGG - Intergenic
915804897 1:158836303-158836325 TTAATTCTTCTTTATATATTTGG + Intronic
915834693 1:159167069-159167091 CTAAGTCATATGTATATATAGGG + Intergenic
916368313 1:164059522-164059544 CTAAGTCACCTTCTTATATTGGG - Intergenic
918107323 1:181426008-181426030 CTCTGTTTTCTTTATAAATTTGG - Intronic
920131966 1:203739144-203739166 CTCAATCATCTTTTTAAGTTTGG + Intronic
920714667 1:208328339-208328361 CTTAGTCATCTTTCTAACTTGGG + Intergenic
921827001 1:219683543-219683565 GTCAGTGATTTTTACATATTTGG + Intergenic
922356583 1:224782313-224782335 CTGAATCTTCTTTGTATATTTGG + Intergenic
1064842538 10:19611053-19611075 CTCAATCATCTTTCTATACTGGG - Intronic
1065299172 10:24305354-24305376 CTCAAGCTTCTTTTTATATTTGG + Intronic
1065439985 10:25743069-25743091 TTAATTCATCTTTAAATATTTGG - Intergenic
1066580620 10:36876925-36876947 CTCAGTTATCCTTATTTTTTAGG + Intergenic
1068527919 10:58152129-58152151 CTCAGACATCTTTCTAGGTTTGG + Intergenic
1068606357 10:59009393-59009415 CTCATTCAGTTATATATATTTGG - Intergenic
1069318664 10:67140473-67140495 TTCAGTCATGTATATATATCTGG - Intronic
1071063827 10:81606808-81606830 CTCATTCATCCTTACATTTTGGG + Intergenic
1071111845 10:82167797-82167819 TTCAATAATCTTTATGTATTTGG - Intronic
1071472662 10:85994854-85994876 CTCAATAAATTTTATATATTAGG - Intronic
1071614227 10:87060138-87060160 GTAAGTCATCTATATTTATTAGG - Intronic
1071973525 10:90931957-90931979 CTCATTCATATTTATTGATTTGG - Intergenic
1073945755 10:108747947-108747969 CTCAGTCTTCTCTCTTTATTTGG + Intergenic
1077745565 11:4900619-4900641 CTCAGTGTTCTTTATAGCTTAGG + Intronic
1078338268 11:10480985-10481007 CTCATTCATCTTTGAATATGAGG + Intronic
1078603140 11:12751008-12751030 CCCAGTCATTTTTCTATGTTTGG - Intronic
1079621385 11:22559336-22559358 CTCATAATTCTTTATATATTGGG + Intergenic
1079690565 11:23411900-23411922 GTCATTGATCTTTATATTTTTGG + Intergenic
1079783041 11:24633324-24633346 TAAAGTCAACTTTATATATTTGG - Intronic
1080152298 11:29067212-29067234 CTAGGTCTTCTTTATATGTTTGG - Intergenic
1080561157 11:33464360-33464382 CTTACTCATCTTTCTATCTTAGG - Intergenic
1085364768 11:75929560-75929582 CTCAGTCATATTTTTATTTTGGG + Intronic
1086245629 11:84748720-84748742 TTAAGTCATCTTGGTATATTTGG + Intronic
1086276534 11:85136385-85136407 CTCTATCATCTTTATATCTGAGG - Intronic
1086551964 11:88063218-88063240 CTTAGTGATCCTGATATATTAGG - Intergenic
1086612278 11:88771815-88771837 CTCAATAATTTTTATATAATCGG + Intronic
1087146436 11:94817361-94817383 CTCATTAATCTTTTGATATTTGG + Intronic
1087160357 11:94942650-94942672 CCCACTCAACTTTATAAATTAGG + Intergenic
1087452124 11:98337487-98337509 TTCAATTATCTTTAAATATTTGG + Intergenic
1088187633 11:107190324-107190346 TTAATTCATCTTTATATGTTTGG + Intergenic
1088596814 11:111447322-111447344 CGCAGTCTTCTTTATAAACTGGG + Intronic
1091074876 11:132606272-132606294 CTCATTTATCTATATATATCTGG - Intronic
1094352267 12:29540318-29540340 CTCATTCAGCATTATAAATTTGG + Intronic
1096936221 12:55280461-55280483 ATCAGTTATCTATATATAATAGG - Intergenic
1097024081 12:56041489-56041511 CTCATTCATCTTTTTATCTCTGG - Intergenic
1097889529 12:64763572-64763594 CTCATTCATCTTTATCACTTTGG + Intergenic
1099338294 12:81393796-81393818 CTCAGTCATCTTGATGAATTTGG + Intronic
1100070805 12:90715017-90715039 CTCAGTCATGTTTAAAAAGTGGG + Intergenic
1101220118 12:102630132-102630154 CTCAGTCTTTTTTTTAAATTTGG + Intergenic
1101468125 12:104968741-104968763 CTCAGTCATTTTTGTCTTTTGGG - Intergenic
1105336454 13:19474715-19474737 CTAATTCATCTTTATGGATTAGG - Intronic
1107489870 13:40871058-40871080 CTAATTCATCTTTATAGATTAGG - Intergenic
1107698446 13:43023342-43023364 CTCAGGGAGCTTTATATACTTGG - Exonic
1108510758 13:51153426-51153448 CTCTGTCATGTTTTTTTATTTGG - Intergenic
1109226491 13:59702271-59702293 CTCAGTCTTCATTATAAGTTAGG - Intronic
1109336329 13:60999345-60999367 TTCATTCCTCTTTAGATATTTGG + Intergenic
1109445842 13:62439121-62439143 CTCAGTCATCTTTTAGGATTTGG - Intergenic
1109767571 13:66924439-66924461 TTCAATCATCTTTTTAAATTAGG + Intronic
1111270315 13:85873653-85873675 CTAATTGATCTTTATATTTTTGG + Intergenic
1111335234 13:86812776-86812798 TTCTGAGATCTTTATATATTTGG + Intergenic
1112963699 13:105160698-105160720 CTCAATCATCCTAAAATATTAGG + Intergenic
1114700222 14:24670121-24670143 CTAGGTCAGCTTTATGTATTTGG - Intergenic
1116092166 14:40322797-40322819 CTCCGTTTTCTTTATGTATTGGG + Intergenic
1116560214 14:46369021-46369043 ATCAGACATTTTTATATAGTAGG - Intergenic
1119986274 14:79141852-79141874 CTCAAACTTCTGTATATATTCGG + Intronic
1121072934 14:91041203-91041225 CTCAATCATCCTTATTTAATAGG + Intronic
1122763121 14:104044529-104044551 CTCTGACATTTTTATATATGTGG + Intronic
1123667528 15:22619703-22619725 CTCAGCAATATTGATATATTGGG + Intergenic
1123950733 15:25271410-25271432 CTCAGTCATCCTTATCTAAGGGG - Intergenic
1124321372 15:28714266-28714288 CTCAGCAATATTGATATATTGGG + Intronic
1124522467 15:30416088-30416110 CTCAGCAATATTGATATATTGGG + Intergenic
1124536197 15:30550126-30550148 CTCAGCAATATTGATATATTGGG - Intergenic
1124762455 15:32457465-32457487 CTCAGCAATATTGATATATTGGG + Intergenic
1124776173 15:32591606-32591628 CTCAGCAATATTGATATATTGGG - Intergenic
1125021458 15:34990652-34990674 CTGCTTCATCTTTATATAATTGG - Intergenic
1125160075 15:36632775-36632797 ATCAGTCATCTTTTTAAATGTGG - Intronic
1126427137 15:48540095-48540117 CAAAGTCATCTTTATTTTTTTGG + Intronic
1126463895 15:48943084-48943106 CTCAATAATCTTTATGTATGTGG + Intronic
1126991538 15:54383109-54383131 TTCATTCTTCTTTATATGTTTGG - Intronic
1127010732 15:54624639-54624661 CTAACTGATCTTTACATATTTGG - Intronic
1127023045 15:54772390-54772412 CACAAAAATCTTTATATATTTGG + Intergenic
1127739643 15:61889979-61890001 CTTAGTCATCTTTCTATCCTCGG + Intronic
1128834366 15:70797205-70797227 CTCCTTCATATTTATATGTTGGG + Intergenic
1131664052 15:94550783-94550805 CTCAATCATCTTTCTCTACTGGG - Intergenic
1131843538 15:96464532-96464554 TTCAGTCATCTCTCTATATTGGG - Intergenic
1133667199 16:7980087-7980109 CTCATTATTATTTATATATTTGG - Intergenic
1136932851 16:34434855-34434877 CTCATTCATCTCTTTATATGGGG - Intergenic
1136971721 16:34976959-34976981 CTCATTCATCTCTTTATATGGGG + Intergenic
1139031481 16:62887060-62887082 CTCAGTCTTTTTGTTATATTTGG - Intergenic
1139874527 16:70134827-70134849 CTCTTTCATCTTTTTAAATTTGG - Intronic
1139894641 16:70278744-70278766 CTCACTCATCTCTGTATCTTCGG + Intronic
1144190856 17:12844159-12844181 CTCACTCATCTTTTTCTCTTAGG + Intronic
1147010236 17:37440240-37440262 CTCAGTCATCTTTCTTTAAGTGG + Intronic
1150809543 17:68345873-68345895 CTCAATCTTTTTTATTTATTTGG + Intronic
1151055678 17:71028244-71028266 CTCTGTCATCTATAGGTATTTGG - Intergenic
1151066856 17:71160919-71160941 CTCAGTCTTCTTTCTATAAATGG - Intergenic
1151513189 17:74574823-74574845 CTCAAGCTTCTTTTTATATTGGG + Intergenic
1151720498 17:75852820-75852842 CTTAGACATGTTTATATTTTAGG - Intronic
1152048115 17:77952101-77952123 CCCAGTCTTCTTTATTTCTTTGG - Intergenic
1153582245 18:6585743-6585765 CTAGTTCTTCTTTATATATTTGG - Intronic
1154403206 18:14062579-14062601 CTCATTCATATTTACATAATAGG + Intronic
1157222577 18:45838326-45838348 TTCAGGCATCTTTGTATATCAGG - Intronic
1158693792 18:59685079-59685101 CTGAGCCATGTTTATATCTTGGG + Intronic
1159744630 18:72216179-72216201 ATATGTTATCTTTATATATTTGG - Intergenic
1159752307 18:72318186-72318208 CTCAGTCGTCTTTCTCTGTTGGG - Intergenic
1166579386 19:43880368-43880390 TTCATTTATTTTTATATATTTGG - Intronic
1168547665 19:57267118-57267140 CTTAATCATCTTGATATTTTAGG + Intergenic
927714707 2:25343813-25343835 CTCAGTCATCCTTCTATAAACGG - Intergenic
927816975 2:26227062-26227084 TTCAGAGTTCTTTATATATTAGG - Intronic
928195427 2:29213413-29213435 TTTAGTCATCTTTGTATACTTGG - Intronic
928238235 2:29563988-29564010 CTCAAGCTTCTTTTTATATTGGG - Intronic
928802707 2:35113618-35113640 ATCAGTCTTCTTTAAATGTTTGG - Intergenic
930546600 2:52775095-52775117 CTTAGCCATCTTTTTATATTTGG - Intergenic
930884578 2:56310525-56310547 CACAGTGATGATTATATATTAGG + Intronic
932170057 2:69546515-69546537 TTCATTCATCTTTGAATATTTGG - Intronic
932531173 2:72534758-72534780 CTCAGTGATCTTTGTAACTTTGG - Intronic
932737001 2:74261231-74261253 CTCAGTTATCATTGTATATGAGG - Intronic
933332842 2:80916722-80916744 TTCATTCTTCTTTAAATATTTGG + Intergenic
933571027 2:84012347-84012369 CTCAGTTAACTATATTTATTTGG - Intergenic
933762865 2:85685275-85685297 CTCACTGATGTTTATATTTTGGG + Intronic
934032344 2:88059407-88059429 CTTACTCATCTTTATATCTGGGG + Intergenic
935100265 2:99987983-99988005 CTTATTCATCTTTATATCCTTGG - Intronic
935134023 2:100283427-100283449 AACAGTCATCTTTTTCTATTGGG - Exonic
935847375 2:107181458-107181480 CACATTCATCTTTATAATTTAGG - Intergenic
937601021 2:123732089-123732111 CACAGTGATCTTGTTATATTTGG - Intergenic
937685121 2:124687338-124687360 CACAGTCATCTAGATAAATTGGG - Intronic
937792230 2:125974040-125974062 CTCATTCATCCTTCTTTATTAGG + Intergenic
937861004 2:126709138-126709160 CTCAGTCCTCCATATATTTTTGG - Intergenic
939371429 2:141306223-141306245 CTCATTCTTCTTTATATGTCTGG + Intronic
939678180 2:145097919-145097941 CTGATTCTTCTTTATATGTTAGG + Intergenic
939678442 2:145100969-145100991 CTGATTCTTCTTTATATGTTAGG - Intergenic
940319654 2:152363375-152363397 TTCAGTCATCCTCATACATTGGG - Intronic
940950903 2:159673132-159673154 CTAAGACTTCTTTATATATTAGG - Intergenic
942126780 2:172834054-172834076 CTTATTCATCCTTATCTATTTGG + Intronic
943043669 2:182832579-182832601 CTCTGTCACCTTTAAATATAGGG + Intergenic
943493638 2:188588679-188588701 CTCAATCAGCTTCATATAATTGG - Intronic
946829116 2:223709850-223709872 ATCAGTCAACTTTAAATATTAGG - Intergenic
947063640 2:226195344-226195366 CTTATTCATCTTTATATCTTTGG + Intergenic
1173039520 20:39448667-39448689 CTCAAACATCTTTCTATATCTGG - Intergenic
1175627033 20:60497457-60497479 CTCAGTCATCTTTCTATGCATGG - Intergenic
1178220079 21:30646159-30646181 CTCACTCATCTGTTTATTTTAGG - Intergenic
1178380937 21:32107541-32107563 CTCATACATTTTTATTTATTTGG + Intergenic
1178417749 21:32417599-32417621 ATCAGTCAGGTTTATTTATTGGG - Intronic
1179958523 21:44754812-44754834 CTTGGTCATCTTTATATTCTGGG - Intergenic
1181827549 22:25530486-25530508 TTCATTCTTCTTTAAATATTTGG + Intergenic
1182407647 22:30150748-30150770 CTCAGTCCTCTATCTCTATTTGG - Intronic
1182649287 22:31837674-31837696 CTGTGTCCTCTTTTTATATTTGG + Intronic
949979245 3:9490335-9490357 CTCAGTAATTTTTGTATGTTTGG - Intergenic
950858645 3:16128150-16128172 TTTAGTCACCTTTATATCTTAGG + Intergenic
951782645 3:26381533-26381555 TTCAGTTCTGTTTATATATTGGG - Intergenic
951966629 3:28393350-28393372 TTAATTCATCTTTAAATATTTGG - Intronic
953487342 3:43314264-43314286 CTTAAGCATCTTTATTTATTTGG + Intronic
954008475 3:47613266-47613288 CAAAGTCATTTTTATATACTTGG - Intronic
955527808 3:59838934-59838956 ATCAATTATATTTATATATTTGG + Intronic
956489932 3:69760130-69760152 CTCAGTCAACTTTAAAGATCTGG - Intronic
957481128 3:80796057-80796079 CACAGTGCTCTTTATATAGTTGG - Intergenic
957559608 3:81805510-81805532 CTCAGTAATTTTTATTCATTTGG - Intergenic
957828065 3:85476246-85476268 TTCATACATCTTTATAAATTGGG + Intronic
958064055 3:88519995-88520017 CTAGTTCTTCTTTATATATTTGG + Intergenic
959996019 3:112681275-112681297 CTAATTCTTCTTTAAATATTTGG + Intergenic
960467685 3:118017488-118017510 CTCTGGCATCCTTATTTATTGGG - Intergenic
961321040 3:126076099-126076121 GTAAGTATTCTTTATATATTTGG - Intronic
962646222 3:137443668-137443690 TTCAGTCAACTGTATATATGAGG - Intergenic
963685533 3:148429054-148429076 GCCAGTCATCTGCATATATTGGG - Intergenic
967485444 3:190024745-190024767 CTCAGTCTTTCTTTTATATTGGG - Intronic
968322969 3:197787827-197787849 CTCAGTCATCTCCATAAAGTAGG - Intergenic
971520476 4:27544045-27544067 CTTATTCATTTTTATGTATTTGG - Intergenic
971646175 4:29206633-29206655 CTTTGTCATCTTTGTATATCTGG - Intergenic
972745696 4:41930431-41930453 CTCAGGCAACTGTATGTATTTGG + Intergenic
973319311 4:48793971-48793993 CAGAGTCCTCTTAATATATTTGG + Intergenic
973397231 4:49605657-49605679 CTCATTAATATGTATATATTCGG + Intergenic
974407914 4:61499466-61499488 TTAAGTCATCTTTACATATATGG - Intronic
974610658 4:64210954-64210976 CCCAGTCATGTTTTTATCTTAGG + Intergenic
974746002 4:66076827-66076849 CATAGTCTTCTTTAAATATTGGG - Intergenic
976063793 4:81160398-81160420 CTCATTTCTCTTTATATCTTTGG - Intronic
976946747 4:90779819-90779841 CTCAGTCAACTGTATTTAATAGG - Intronic
977117994 4:93057205-93057227 CTTAGACATCTTAGTATATTTGG + Intronic
979428428 4:120596789-120596811 CCAACTCTTCTTTATATATTTGG - Intergenic
980809469 4:137856492-137856514 CTTAGTGATCATTACATATTAGG + Intergenic
980834811 4:138178000-138178022 CTCAGGCAGTTTTATATTTTAGG - Intronic
981330861 4:143507929-143507951 TTAATTCATCTTTAAATATTTGG + Intergenic
983567595 4:169170609-169170631 CTCATTCATCTTCATATCCTGGG + Intronic
983736984 4:171073853-171073875 CTCAGTAACATTTATATATAAGG + Intergenic
985348439 4:189032646-189032668 CTCAGCCATTTTTATATCTTTGG - Intergenic
985353365 4:189091055-189091077 CTCTATCAACTGTATATATTGGG - Intergenic
986114469 5:4758057-4758079 CTGAATCATCTTTTTATTTTGGG + Intergenic
986431647 5:7687194-7687216 GTCAGTCATCCTTCTACATTTGG + Intronic
987577493 5:19749926-19749948 TTCAGTAATATTTATATTTTTGG + Intronic
987679746 5:21119822-21119844 CTCATGCTTCTTTTTATATTGGG + Intergenic
988031198 5:25765445-25765467 CACACACATATTTATATATTTGG + Intergenic
988288214 5:29249935-29249957 CTCAGTGATATTTATATTTCCGG - Intergenic
989272803 5:39552543-39552565 GTCAGTCATCATGACATATTTGG + Intergenic
990188237 5:53230546-53230568 CTCAGTCAGCTGCAGATATTAGG - Intergenic
990965975 5:61448327-61448349 CACTTTCTTCTTTATATATTTGG + Intronic
991125765 5:63068108-63068130 CTCAGTCCACTTTAATTATTTGG + Intergenic
991296773 5:65089971-65089993 CTTATTCATCTTTATATCCTGGG - Intergenic
992523991 5:77587748-77587770 ACCAGTCATATTAATATATTAGG - Intronic
993056567 5:82988019-82988041 ATTAGTCTTCTTTTTATATTAGG - Intergenic
993080496 5:83291712-83291734 CCAAGTCATCTTAATTTATTAGG + Intronic
995051320 5:107708030-107708052 CTCAGTCATTTTTACAAATTAGG - Intergenic
996927863 5:128849970-128849992 TTAAGTCATCTTTAAATTTTTGG - Intronic
997494109 5:134306702-134306724 CTCATTCATTTTTAAATAATAGG - Exonic
999315451 5:150580522-150580544 CTGATTCATCTTTGTATCTTGGG + Intergenic
1000110237 5:158101221-158101243 CACCATCATCTTTGTATATTAGG + Intergenic
1000520536 5:162289544-162289566 CTCAATCATCATTATAAATAAGG - Intergenic
1000952617 5:167502829-167502851 AGCAGACATTTTTATATATTTGG - Intronic
1001168417 5:169392769-169392791 CTCAGTCATCTTCATAGAAATGG + Intergenic
1002763633 6:220210-220232 CTCACACACTTTTATATATTAGG - Intergenic
1004082437 6:12407820-12407842 CTTATTCATCTTTATACCTTCGG + Intergenic
1004109325 6:12699911-12699933 CCCAGTCATCGTTATTTTTTAGG - Intergenic
1005216332 6:23532616-23532638 TTGAGTCATCTTGGTATATTAGG - Intergenic
1005526033 6:26650102-26650124 TTAAGAGATCTTTATATATTAGG - Intronic
1006471797 6:34233839-34233861 TTGAGTCAACTTTATATTTTGGG - Intergenic
1008286729 6:49662080-49662102 CTCAGGCATCAATAGATATTTGG - Intergenic
1008483953 6:52015182-52015204 CTAAGTCACCTTTAAAAATTAGG - Intronic
1008654972 6:53602686-53602708 CTCAGTCATTTTTATCTATAGGG - Intronic
1008844609 6:55948554-55948576 CTAAGAGTTCTTTATATATTGGG - Intergenic
1009830524 6:68925838-68925860 CTGATTCATCTTTATAACTTTGG + Intronic
1009892429 6:69703506-69703528 GTCAGTCATCTCTACAGATTTGG - Intronic
1009955843 6:70451782-70451804 CTCAATCAACATTATAAATTAGG - Intronic
1010587898 6:77676853-77676875 CTAATTCATCTTTTTATGTTTGG + Intergenic
1010831884 6:80541176-80541198 CTCAGTCATCATTTTATCTCAGG + Intergenic
1011184782 6:84662197-84662219 CTCAGTCATCTTTGTATCCTTGG - Intergenic
1011431162 6:87288316-87288338 CTCTTTCATATGTATATATTTGG + Intronic
1012641718 6:101625769-101625791 CTCAGTCATCTTTATATATTTGG - Intronic
1013969815 6:116003210-116003232 CTAAGTCATCTCTAAATATGAGG - Intronic
1014576219 6:123076786-123076808 CTCTGTGATGTTTATATACTTGG - Intergenic
1014658591 6:124137706-124137728 ATCAGTTGTCTTTAAATATTTGG - Intronic
1015274764 6:131372800-131372822 CTCAGTCACCTTTGTAGATCCGG + Intergenic
1015759279 6:136640685-136640707 CTTAGTCATTTTTGTATCTTTGG + Intronic
1016806609 6:148218360-148218382 CTCTGTCATCTTTACATGTTAGG - Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020733918 7:11921563-11921585 TTCATTCTTCTTTAAATATTTGG - Intergenic
1022312408 7:29209434-29209456 GTCAGTCATCTTAATGTAGTAGG - Intronic
1022958215 7:35400881-35400903 CTCACTCATCTTTTTAAATAAGG + Intergenic
1023073975 7:36465087-36465109 CTCAAGCTTCTTTTTATATTTGG + Intergenic
1024277848 7:47693374-47693396 CTTAGTTATCTTTGTCTATTTGG + Intergenic
1024917498 7:54518160-54518182 TTAATTCATCTTTACATATTTGG + Intergenic
1025612313 7:63086183-63086205 CTGAGACATCTTTCTCTATTAGG - Intergenic
1026427029 7:70305128-70305150 CTAACCCATTTTTATATATTTGG + Intronic
1028317334 7:89419845-89419867 GTCACTCATTTTTAGATATTTGG + Intergenic
1028676212 7:93464870-93464892 CTACGTCATCTCTACATATTGGG - Intronic
1029011466 7:97266335-97266357 CTCAAACATCTTTTTATGTTGGG + Intergenic
1030620632 7:111786340-111786362 CTCATTCCGCTTTATCTATTGGG - Intronic
1030695936 7:112585464-112585486 TGCAGTCATCTTTATACCTTAGG + Intergenic
1031438184 7:121759216-121759238 CCAAGTCTTCTTTAAATATTTGG - Intergenic
1032143472 7:129356505-129356527 CACAGGCAGCTTTATAGATTTGG - Intronic
1032627863 7:133612148-133612170 CTCAGACATTTATATATATATGG + Intronic
1032669636 7:134071448-134071470 CTCAAGCTTCTTTTTATATTGGG + Intergenic
1034739932 7:153464590-153464612 CTCACTCATCTTTCTCTATTTGG + Intergenic
1034745548 7:153520690-153520712 GTAAGTATTCTTTATATATTTGG - Intergenic
1034916553 7:155044649-155044671 CTCAAGCTTCTTTTTATATTGGG - Intergenic
1036913570 8:12782423-12782445 CTCATTCTTCTTTAAATGTTTGG + Intergenic
1037111356 8:15167652-15167674 CTCAGTCCTTTTTATAATTTGGG + Intronic
1038764819 8:30417242-30417264 TCCAGTCATCGTGATATATTTGG - Intronic
1039000073 8:32970102-32970124 GTCAAGCTTCTTTATATATTTGG - Intergenic
1039727957 8:40241378-40241400 CTCAATCATCTTTAAATTCTTGG - Intergenic
1040542486 8:48372667-48372689 CTGTGTCATCTTTTTATTTTGGG + Intergenic
1041151567 8:54941045-54941067 CTGAGTCATATTTTTAGATTTGG - Intergenic
1041959015 8:63590454-63590476 TTCATTCTTCTTTAAATATTTGG + Intergenic
1041967586 8:63697915-63697937 CTCAGTCATAACTACATATTAGG + Intergenic
1042309140 8:67363110-67363132 CTCAGATATCTTAATATATTAGG + Intergenic
1043422805 8:80116558-80116580 TTCATTCTTCTTTAAATATTTGG - Intronic
1046284057 8:112073185-112073207 CTCAGTTATTTTTAAGTATTAGG - Intergenic
1046590725 8:116203082-116203104 CTTAGTTATCTTTATATCTCTGG + Intergenic
1051780934 9:20688309-20688331 CTCAATCACCTTAATATATCTGG - Intronic
1052151199 9:25117945-25117967 CTCAATCATCTTTCTTTTTTTGG + Intergenic
1052785548 9:32824753-32824775 CTCAGGCTTCTTTTTATATTGGG - Intergenic
1056853066 9:90100553-90100575 CTCAGTCACGTTTATATCTTTGG - Intergenic
1057532405 9:95862748-95862770 CTCACTCCTCTTTATTTTTTTGG + Intergenic
1057951200 9:99370208-99370230 CCAAGTCATTTTTGTATATTTGG + Intergenic
1059140619 9:111849458-111849480 CTCATTCATCTTTTTGTATGGGG - Intergenic
1186205568 X:7196775-7196797 CTGAGTCATCTTCATGTCTTAGG + Intergenic
1186767302 X:12783876-12783898 CTCACTGATTTTTACATATTTGG + Intergenic
1187545013 X:20242033-20242055 CTCAGTTATTTCTAGATATTAGG - Intronic
1188144893 X:26599445-26599467 CTCAGTCATCTTTAATATTTTGG + Intergenic
1188289911 X:28374745-28374767 CTCCCTCATCTCTATATATTTGG + Intergenic
1189269845 X:39743527-39743549 CTCAGCCATCTTCATTTATTCGG - Intergenic
1189879403 X:45473278-45473300 TTCAGTCATCTTGACATAATTGG - Intergenic
1189918924 X:45884494-45884516 CCCAGTCAAGTTGATATATTCGG - Intergenic
1190951534 X:55150035-55150057 CTCATTAATCTTTTAATATTAGG + Intronic
1193491189 X:82150506-82150528 TTCATTCTTCTTTATAAATTTGG - Intergenic
1193874153 X:86839567-86839589 TTCATTCATCATTTTATATTGGG - Intergenic
1193950324 X:87789112-87789134 CAAAGTCATTTTTATATTTTTGG + Intergenic
1193968159 X:88015776-88015798 CTGATTCATCATTGTATATTAGG + Intergenic
1195981029 X:110578555-110578577 TTTAGTCATCTTTATCTCTTAGG - Intergenic
1196501307 X:116386294-116386316 CACAGACATCTTTAAATTTTAGG + Intergenic
1196865104 X:120064152-120064174 ATCAGACATCTTTAAACATTTGG - Intergenic
1196877989 X:120172128-120172150 ATCAGACATCTTTAAACATTTGG + Intergenic
1199795606 X:151192415-151192437 CTCAATCATCTTTGAATACTTGG + Intergenic
1201649605 Y:16270846-16270868 GTCAGTGGTCTTTATAAATTTGG + Intergenic
1202336704 Y:23819431-23819453 TTCAGCCATCTTTAAAAATTTGG - Intergenic
1202534061 Y:25850640-25850662 TTCAGCCATCTTTAAAAATTTGG + Intergenic