ID: 1012642076

View in Genome Browser
Species Human (GRCh38)
Location 6:101631548-101631570
Sequence CTGTGTGTCCCAAAGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 1, 2: 2, 3: 16, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012642076 Original CRISPR CTGTGTGTCCCAAAGGAAAC AGG Intronic
900777911 1:4598694-4598716 TAGTGTGTCCCAGAGGAGACAGG + Intergenic
901854483 1:12035845-12035867 CTGTAAATCCCAAAGGAAAAAGG + Intergenic
905993792 1:42363436-42363458 CTGTGTGTCCAAAAAGAAAGTGG - Intergenic
906197755 1:43939397-43939419 TTGTTTTCCCCAAAGGAAACAGG + Intergenic
906346401 1:45018140-45018162 CTGTGTTTGCCAAGGGAGACAGG + Exonic
907390306 1:54153753-54153775 CTTTGTGTCCAACAGGAAGCGGG + Exonic
907768810 1:57439191-57439213 CTTAGTCTCCTAAAGGAAACAGG + Intronic
908791415 1:67786440-67786462 CTGTGTCTCCCAAGGAGAACTGG + Intronic
911285562 1:95987951-95987973 CTGTATGTCCCATAGGAAAAAGG + Intergenic
911584827 1:99678817-99678839 CTGTGAGTCCCAAAAGAAACTGG + Intronic
911727974 1:101262395-101262417 CTGTGATCTCCAAAGGAAACAGG + Intergenic
915512063 1:156391905-156391927 CTGTGTGTCCCTGAGGACAGTGG + Intergenic
915950973 1:160189827-160189849 CTGAGTGAAGCAAAGGAAACTGG + Intergenic
916616760 1:166449505-166449527 CTGAGTGTCCTGAAGGATACTGG - Intergenic
920471530 1:206234635-206234657 CTGTGTCTCCCGAAGAATACTGG - Intronic
921344508 1:214168378-214168400 CTGTGCCTCCTAAAGGAATCGGG - Intergenic
922301430 1:224304625-224304647 CTGGGTGTAGAAAAGGAAACTGG - Intronic
923349992 1:233094954-233094976 CTGTGTGTTTCCCAGGAAACAGG - Intronic
923482639 1:234397867-234397889 ATGTGGGTCCCAGAGGAAGCTGG + Intronic
923849066 1:237773039-237773061 GTGTCTGTCCCTGAGGAAACTGG - Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1067297727 10:44984364-44984386 CTGTGTGTGCTATGGGAAACAGG + Intronic
1069490842 10:68859048-68859070 CTGTGAGTCCCCAAAGAACCTGG - Intronic
1069777875 10:70937370-70937392 CTGTGTGTCCCAAAACCAAGGGG + Intergenic
1071563566 10:86660311-86660333 CTGTGTGTTCCAAAGGGGGCTGG - Intronic
1073071146 10:100793960-100793982 CTGTGTGTTCCATAGGAATCTGG + Intronic
1073184990 10:101610533-101610555 CTCTGTGTCCCAAAGAACAAAGG - Intergenic
1074753618 10:116609276-116609298 CCGTGTGACCCAAAGTTAACGGG - Intergenic
1074853107 10:117454467-117454489 CTGTGTGTTCCATAGCAACCTGG - Intergenic
1076219402 10:128721008-128721030 CCGTGAGTGCAAAAGGAAACAGG + Intergenic
1076881375 10:133241053-133241075 TTGTGTGTACAAAAGAAAACAGG + Exonic
1077035150 11:490918-490940 CAGTGTGTCCCTCAGGAACCAGG + Exonic
1078470443 11:11581841-11581863 CTGTGGGTCTCAAAGAAAAGAGG - Intronic
1078619899 11:12897629-12897651 CTGTCTTTGCCAAAGGAAACTGG - Intronic
1078754209 11:14193496-14193518 CTGCTTGTCACAAAGGTAACAGG + Intronic
1078808477 11:14732606-14732628 CTGTGTTTGCCAAATCAAACAGG + Intronic
1079679105 11:23271236-23271258 CTTTCTGTCCCAAAGGGAACAGG - Intergenic
1080994255 11:37580802-37580824 CTGTGTGGGCAAAAGGAAAGAGG + Intergenic
1090886093 11:130878155-130878177 CTTCTTTTCCCAAAGGAAACAGG + Exonic
1091102532 11:132888257-132888279 CTGTCTGTCCCAAAGGACCCTGG - Intronic
1092290991 12:7159320-7159342 CTGTTTGTACCAAAGGGATCTGG + Intergenic
1092930463 12:13310673-13310695 CTATTTGTCCCAAAGTAAAAAGG + Intergenic
1096143261 12:49260176-49260198 CTGTGTATCCTAAAGGAATGGGG + Intronic
1098738034 12:74132195-74132217 CTGTTTTACCCAAAGGACACAGG - Intergenic
1102376164 12:112422939-112422961 CTGTGTTTCCCAGAGGGAAGGGG - Intronic
1103238438 12:119394372-119394394 CTGCCTGTTACAAAGGAAACGGG + Intronic
1105299962 13:19124469-19124491 GTGTTTGTCCCCAAGCAAACAGG - Intergenic
1105609029 13:21951422-21951444 CTGTGTGTCACGGAGGAACCTGG - Intergenic
1105714785 13:23052377-23052399 CTGAGTTTGCCAAGGGAAACAGG - Intergenic
1107264050 13:38529986-38530008 GTGTGTGTCCCGTGGGAAACTGG - Intergenic
1107813308 13:44220498-44220520 AGATGTGACCCAAAGGAAACCGG - Intergenic
1108950050 13:56080756-56080778 CTGTGTGTCTTAAAGTAAAAAGG - Intergenic
1110205891 13:72912708-72912730 GTGTGTATCTCAAAGGAAAATGG + Intronic
1112093898 13:96111174-96111196 CAATGTGTCCTAAAGGAAAAAGG + Intronic
1113009709 13:105749963-105749985 ATGTGTGCTCCAAAGGAAAGAGG + Intergenic
1113127627 13:106997852-106997874 CTGTGTGTACAAAAGTAAACGGG - Intergenic
1116666088 14:47777477-47777499 CTGTGTTTCCCAAAGAAACAGGG - Intergenic
1116976012 14:51116804-51116826 CTGAGTGTCCAAAAGTAAATTGG - Intergenic
1117691701 14:58313954-58313976 CTGGGTGTGCCAGAGGAAACTGG - Intronic
1118053870 14:62057707-62057729 CTGGGTCTCGCAAAGGAAAGAGG + Intronic
1118055666 14:62077166-62077188 CTGTGTGGCCTAAAGTAAACAGG - Intronic
1118710157 14:68512214-68512236 CAGTGTGGCCCAAAGGAATCTGG + Intronic
1122667623 14:103344054-103344076 CTGTGTGACCCCAAGGGGACAGG + Exonic
1123780925 15:23627591-23627613 CTGTGTGCCCAAGAGAAAACAGG - Intronic
1127966378 15:63925612-63925634 CAGTCTGTCCCAAAGGCACCTGG - Intronic
1128498068 15:68209531-68209553 CTGTGTGGCCCCAGGGAGACTGG - Intronic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129178662 15:73857766-73857788 GTGTGTCTCCTACAGGAAACTGG + Intergenic
1129891695 15:79075852-79075874 CTGTTTGTCAGAAAGGAACCAGG - Intronic
1130017317 15:80197582-80197604 CTGTGTGTCCCTCTGGACACAGG + Intergenic
1131433074 15:92402012-92402034 CTTAGTATCCCAAAGGAAAAAGG - Intronic
1131798358 15:96043888-96043910 GTGTGTGTGGCACAGGAAACAGG + Intergenic
1132068691 15:98755367-98755389 CTGTGTTTCACTAATGAAACAGG + Intronic
1133097828 16:3458937-3458959 CTGTGTGCCCAAACGGAGACAGG + Intronic
1133213833 16:4278595-4278617 CTCTGTGTCCCCAAGGAACATGG + Intergenic
1134612622 16:15622115-15622137 CTGTGTGTGCCAGAGCACACAGG - Intronic
1134770882 16:16808495-16808517 CTGTGTGTCTAAAAGGAGAGGGG + Intergenic
1135306459 16:21371389-21371411 ATGTGTTTCCCATAGGAAAGAGG + Intergenic
1135596066 16:23744307-23744329 CAGTGGGTCCCATAGGAATCAGG + Intergenic
1136303202 16:29350532-29350554 ATGTGTTTCCCATAGGAAAGAGG + Intergenic
1140973041 16:80031777-80031799 GTGTATGCCCCAAAGGAAAATGG - Intergenic
1141872041 16:86793777-86793799 CTGTGTGACCCACATGTAACGGG - Intergenic
1142670681 17:1486112-1486134 CTGCGGGTCCCAGAGGAAGCGGG + Intronic
1142696737 17:1638176-1638198 CTGTGAGTCTCAAAGGAGCCTGG + Intronic
1143248653 17:5505873-5505895 CTGTGTGTGTGAAAGAAAACGGG - Intronic
1143828967 17:9635846-9635868 CTAAGTGTCCCAAATGAAAGGGG + Intronic
1144312766 17:14028148-14028170 CTGTGTTTGCCAAGGGAGACAGG + Intergenic
1144331990 17:14233179-14233201 CTGTGTTTGCCAAGGGAGACAGG - Intergenic
1144498835 17:15768404-15768426 CTGTGTTTGCCAAGGGAGACAGG + Intergenic
1145162216 17:20583438-20583460 CTGTGTTTGCCAAGGGAGACAGG + Intergenic
1145206935 17:20989624-20989646 CTGTGTCTCCCTAAGGGGACAGG + Intergenic
1146160880 17:30559052-30559074 CTGACGGTCCCAAAGGAACCCGG + Exonic
1146916096 17:36679423-36679445 CAGAGGGTCTCAAAGGAAACAGG - Intergenic
1148253947 17:46112007-46112029 CTGTATTTCCCAAAGGAGAATGG + Intronic
1148527041 17:48349047-48349069 CTGTGTGTGCCCAAGGGAACTGG - Intronic
1150576777 17:66437679-66437701 CTGTGGGTCCCAGAAGCAACTGG + Intronic
1151198121 17:72446177-72446199 CCGTCTGACCCAAAGCAAACTGG + Intergenic
1151280591 17:73071311-73071333 CTTCTTGTCACAAAGGAAACAGG - Intronic
1152885129 17:82845130-82845152 CTGTGTGCCCCTAGGGAAAGAGG - Intronic
1152989654 18:351123-351145 TTGTGTGACCCAAAGTGAACTGG + Intronic
1153974297 18:10253839-10253861 CTGTGTTTCCCAGTGGAAAGTGG - Intergenic
1154294753 18:13138313-13138335 CTGTGGGGCCGAAGGGAAACTGG - Intergenic
1156686452 18:39653410-39653432 CTGAGAGTGCCAAAGAAAACAGG + Intergenic
1158592258 18:58787876-58787898 CTGGGTGGCCCAAAGGAGAAGGG - Intergenic
1158632846 18:59131436-59131458 CTGGGTGTCCCACAGGCCACTGG + Intergenic
1159667021 18:71173882-71173904 CTGTGTGTCCCTCACGTAACGGG + Intergenic
1162099806 19:8333041-8333063 CAGTGTGTCCCACGGGAACCTGG - Exonic
1163101544 19:15100251-15100273 CTGGGTGTACCAGAGGAAGCAGG - Intergenic
1163790200 19:19301965-19301987 CTGTGTGTCCCAAAGGCAACTGG + Intronic
1165317783 19:35067051-35067073 GTGGGAGTCCCAAAGGAAATAGG + Intergenic
1165825795 19:38705112-38705134 GTGAGTGACCCCAAGGAAACAGG - Intronic
1166427495 19:42692547-42692569 CTGTGTGTTCCCAAAGAAAATGG - Intronic
1167776925 19:51564568-51564590 CTGGGGGTCCCCAAGGAAATTGG + Intergenic
1167783003 19:51612653-51612675 CTGTATGTCCCATAGGGAGCTGG - Intronic
1167915083 19:52734316-52734338 TTGTGTGGGCCAAAGGAATCAGG - Intronic
1167946411 19:52992621-52992643 TTGTGTGGGCCAAAGGAATCAGG - Intergenic
1167960700 19:53102703-53102725 ATGTGTGGCCCAAGGGAATCAGG - Intronic
1167999437 19:53432654-53432676 CTGTGTGGGCCAAAGGGATCAGG + Intronic
926004086 2:9358487-9358509 CTGTGTGTGCAAAAATAAACAGG - Intronic
926327462 2:11797638-11797660 CAATTTGTCCCAATGGAAACAGG + Intronic
926814599 2:16787836-16787858 CTGTGCATCCCAAAGGACTCTGG - Intergenic
929318886 2:40515579-40515601 CTGTGAGTGCCAAAGGACAGGGG + Intronic
930200328 2:48546552-48546574 CTTTGTGTCCCACAGAACACTGG + Intronic
931593362 2:63911161-63911183 CTGTATATCAAAAAGGAAACTGG + Intronic
932355215 2:71062781-71062803 TTGTGTGTCCCAGAAGAAAGAGG - Intergenic
933316719 2:80724330-80724352 CTCTGTGTCCAGAAGGAAAAGGG - Intergenic
933391459 2:81674131-81674153 CTGTGTTTCCTAGAGGAAAAAGG - Intergenic
933629560 2:84640254-84640276 CTTTCTGTGCCACAGGAAACGGG - Intronic
934570971 2:95373134-95373156 CTGTGTGGCCCAGGGGAGACAGG + Intronic
934852545 2:97710680-97710702 CAATGAGCCCCAAAGGAAACAGG - Intergenic
935336534 2:102022037-102022059 CTTTGTCTGGCAAAGGAAACAGG - Intronic
935420178 2:102859371-102859393 CTGTTAGTCACAAAGGAACCAGG - Intergenic
936375465 2:111937491-111937513 ATGGGGGCCCCAAAGGAAACAGG - Intronic
940894601 2:159068746-159068768 CTGTCTGTCTCAAAAGACACAGG - Intronic
943285374 2:185991751-185991773 CTGTGTGACCCATAGAATACAGG - Intergenic
943358026 2:186882996-186883018 CTTTTTATCCCCAAGGAAACAGG - Intergenic
944860989 2:203815933-203815955 CTGATTGTGACAAAGGAAACCGG + Intergenic
945176903 2:207052379-207052401 CTGTGTGTCCCAGAGAAGATGGG - Intergenic
946054833 2:216891687-216891709 ATGTGAGTCCCACAGGGAACTGG + Intergenic
946326684 2:218988224-218988246 CTGTGGGCCCCAGAGGAACCTGG - Intergenic
947339885 2:229127175-229127197 CTGTGTGTCCAGGAGGAAAGGGG + Intronic
948947637 2:241229156-241229178 CTGTCTGGACCAAGGGAAACTGG + Exonic
1169003336 20:2184556-2184578 CTGTGAGAGCCAAAGGAAATGGG - Intergenic
1173138766 20:40463501-40463523 CTTTGGAGCCCAAAGGAAACAGG + Intergenic
1173583846 20:44166884-44166906 CCCACTGTCCCAAAGGAAACGGG + Intronic
1173792575 20:45837235-45837257 CAGTGTGTCCTGAAGAAAACTGG + Intronic
1175955187 20:62605439-62605461 CTGTGGGTCCCCAAGGCTACAGG - Intergenic
1177901303 21:26919170-26919192 TTGGGTGTGCCAAAGGAAAGTGG + Exonic
1180108027 21:45632762-45632784 CTCTGCGTCCCACTGGAAACAGG + Intergenic
1183092168 22:35529926-35529948 CTGGGAGTCCCCAAGGAACCTGG - Intergenic
1183107798 22:35627409-35627431 CTACGTGTCCCAAAGGAAACTGG - Intronic
1183345346 22:37304367-37304389 CCCTGTGGCCCATAGGAAACAGG - Intronic
1183661125 22:39221999-39222021 CTCTCTCTCCCAAAGTAAACGGG + Intergenic
1183752882 22:39732115-39732137 GTGTGTGCCCCAAAGTAAATAGG - Intergenic
1184832839 22:47000635-47000657 ATGTCTGTCCCGAAGGATACAGG - Intronic
1185148475 22:49151617-49151639 CTGTGTGTCCCACTGGAGGCAGG + Intergenic
949332084 3:2933749-2933771 GTGAGTGTCCAATAGGAAACTGG + Intronic
950026969 3:9826842-9826864 CTGGCTTTCCCAAAGGGAACTGG + Intronic
951613560 3:24519280-24519302 CTGGGTATCCCAAGGGAACCTGG + Intergenic
954907793 3:54077490-54077512 CAATGTGTCCCTGAGGAAACAGG - Intergenic
956571397 3:70700192-70700214 CTGGGTGTCCCATAGGCAATTGG - Intergenic
957967299 3:87338895-87338917 CTGTGTGACCCAAGGCAAATTGG - Intergenic
960496405 3:118380788-118380810 CTGTGAGTCAGACAGGAAACTGG + Intergenic
961757082 3:129134639-129134661 CTGTGTGGGCCAGAGGTAACAGG - Intronic
962498760 3:135967660-135967682 CTGTGTGTTTGAAAGGTAACAGG - Intronic
964427795 3:156571406-156571428 CTGTGTGGACCAAAGGAAGTAGG + Intergenic
965036435 3:163444916-163444938 CTTTGTGTTTCAAGGGAAACAGG - Intergenic
966869898 3:184283637-184283659 CAGTGTGTCAGAAATGAAACAGG + Intronic
968038764 3:195570930-195570952 TCTTGTTTCCCAAAGGAAACTGG - Intronic
970861787 4:20712585-20712607 CTTGGTATCCCAAGGGAAACTGG - Intronic
972815388 4:42639350-42639372 CTTTGTGTCCCAGATGAAAGGGG - Intronic
974466849 4:62268862-62268884 CTGTGAATACAAAAGGAAACAGG + Intergenic
975251896 4:72189917-72189939 TTGTGTGTCCCACAGTAAAAGGG + Intergenic
976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG + Intergenic
977940652 4:102854888-102854910 CTGATTGTCCCAAAGCAAAGTGG - Intronic
983693851 4:170504809-170504831 CTGTGTATCTCAAAGTAGACTGG - Intergenic
983915351 4:173286249-173286271 CATTTTCTCCCAAAGGAAACTGG - Intronic
984142450 4:176020283-176020305 CTGTATGCCCCAAAGGATATGGG + Intergenic
984870110 4:184317847-184317869 CTGCATGACCCAAATGAAACAGG - Intergenic
990622470 5:57575889-57575911 CTGTGGGTTCCCCAGGAAACAGG + Intergenic
991169448 5:63604110-63604132 CTCTGTGTCTCCAAGTAAACTGG - Intergenic
991974982 5:72176800-72176822 CTGGGTGTCTCAGAGGCAACAGG - Intronic
994613445 5:102074983-102075005 CTGTGTGCCCAAGAGGAAAAGGG - Intergenic
998050109 5:139025252-139025274 CTCTGTTTCTCAAAGGCAACTGG - Intronic
998134948 5:139669644-139669666 TTGTGTGACCCCAAGGACACAGG + Intronic
998567185 5:143226077-143226099 CTGGGTCTTACAAAGGAAACTGG - Exonic
1006552697 6:34838370-34838392 CTGTGTGTCACCAAGTAATCTGG - Intronic
1006910140 6:37558369-37558391 CTGTGAGGCCCAAAGGAGAATGG + Intergenic
1011133501 6:84075286-84075308 CTGTGTATCCAGAAGGAAAGAGG + Intronic
1011901267 6:92301576-92301598 CTCTGTTTCTCAAAGTAAACTGG + Intergenic
1012642076 6:101631548-101631570 CTGTGTGTCCCAAAGGAAACAGG + Intronic
1013196131 6:107846843-107846865 GTGTGTGTCCCATAGGATAGTGG + Intergenic
1013249297 6:108318179-108318201 CTCTGTGTGCCCAAGGAAAGTGG + Intronic
1016870523 6:148811731-148811753 ATGAGTGTCCCAAGGGAACCAGG + Intronic
1017524422 6:155230127-155230149 CTGTGTGTCCAGTAGGCAACAGG + Intronic
1017865186 6:158436905-158436927 TTTTGTATCCCAAAGCAAACAGG - Intronic
1018339683 6:162838510-162838532 CTGTGTACCTCAAAGGAAAAGGG + Intronic
1020029330 7:4921720-4921742 AGGTGAGTCCCAAAGGAAAGAGG + Intronic
1022834148 7:34097740-34097762 CTTGGTGACCCAAAGGAATCTGG - Intronic
1023185271 7:37526571-37526593 CAGTGTGACCAAAAGGAATCTGG - Intergenic
1028328990 7:89564650-89564672 CTGTGGGTGCCAATGGAAATTGG + Intergenic
1029273255 7:99389673-99389695 CTGTGTGGCCTAAAGGATAGAGG + Intronic
1029571622 7:101373552-101373574 CTCGGTGTCCCAAAGGAGAAAGG - Intronic
1029645647 7:101854119-101854141 CTTTCTGTTCCAAAGCAAACAGG + Intronic
1030187573 7:106778642-106778664 CTGTGGGTCCCAAAGAAAAGAGG - Intergenic
1030801227 7:113855748-113855770 CTGTGTGTCCAAAAGAAAATAGG + Intergenic
1032809172 7:135392809-135392831 TTGTCGGTCCCAAAGGGAACAGG + Intronic
1037110341 8:15158046-15158068 TTGTGTTTGCCAAAGGAAAGGGG - Intronic
1037151161 8:15636631-15636653 TTGTGTGTCCCCAAAGATACGGG + Intronic
1037967452 8:23145492-23145514 CTGTGTATCCCCAAGGACCCTGG - Intronic
1038083540 8:24167762-24167784 CTGTGTGTCTCCAAGAAAACTGG - Intergenic
1039187287 8:34931326-34931348 CTGAGTGTCCCAAACCACACAGG - Intergenic
1039238197 8:35525950-35525972 GTGTGTGTCCCAAATATAACTGG + Intronic
1040617614 8:49054133-49054155 GTCTGTGTCCCAGAAGAAACTGG + Intergenic
1043484478 8:80685588-80685610 CTGTGGGTCCCCAGGGACACTGG - Intronic
1045192952 8:99901144-99901166 CTGTGTGTCTGAAAGGAGAATGG - Intergenic
1045299926 8:100902198-100902220 CTGAGTGTAACAAAGGAAAAAGG + Intergenic
1049924474 9:395182-395204 CTCTGTGTCCCAAACCAAAGAGG + Intronic
1051261359 9:15268404-15268426 CTGTGTGGCACAGAGTAAACTGG - Intronic
1053463529 9:38288730-38288752 CTGGGTGTCCCCAAGGAGACTGG - Intergenic
1056759000 9:89401763-89401785 CTGCATTTCCCAAAGGAAATGGG + Intronic
1057522579 9:95771976-95771998 CTATGTGTGCAAAAAGAAACAGG - Intergenic
1186608882 X:11119334-11119356 CTGTGTGTGTTAAAGGAGACAGG + Intronic
1187239138 X:17496509-17496531 CTTTGTGTCCCAAAATCAACAGG - Intronic
1189033429 X:37472210-37472232 CTGTGTTTTCCAAATGAAACTGG - Intronic
1189184479 X:39041402-39041424 CTTTAATTCCCAAAGGAAACAGG + Intergenic
1189356350 X:40312825-40312847 CTGTCTCCCCCAAAGGAAAGGGG - Intergenic
1192238446 X:69311495-69311517 CTATGTGTCCCAAAGTAAGATGG - Intergenic
1194229799 X:91307555-91307577 CTCTGTGTCTCCAAGTAAACTGG - Intergenic
1198824820 X:140688573-140688595 ATTTGTCTCCCAGAGGAAACTGG - Intergenic
1201400751 Y:13601473-13601495 CAGTGTGTCCCAAGGTAGACTGG - Intergenic