ID: 1012645696

View in Genome Browser
Species Human (GRCh38)
Location 6:101677869-101677891
Sequence GTGAAAATCAACATTTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 326}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012645696_1012645697 26 Left 1012645696 6:101677869-101677891 CCAATATAAATGTTGATTTTCAC 0: 1
1: 0
2: 2
3: 25
4: 326
Right 1012645697 6:101677918-101677940 AATTGCTATAGTTTTATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012645696 Original CRISPR GTGAAAATCAACATTTATAT TGG (reversed) Intronic
907361502 1:53919753-53919775 ATGAAATTAAACATTGATATAGG - Intronic
907861469 1:58357807-58357829 GTGAAATCCAACATCTATAGTGG + Intronic
907952316 1:59195718-59195740 CTGAAAATCTACATTTTGATGGG + Intergenic
907999498 1:59666404-59666426 TCGAAAATCAAAATTTATTTGGG - Intronic
908081596 1:60585540-60585562 ATGAAAATCAACATGAAAATAGG - Intergenic
908082243 1:60593455-60593477 ATGAAAATCAACACTTAAGTGGG - Intergenic
908164759 1:61447172-61447194 GTGAAAATCAAAAATTACAAAGG + Intronic
908677916 1:66626855-66626877 GGGAAAAGCAACAGTTGTATGGG + Intronic
909232546 1:73108458-73108480 ATGATAATAAACACTTATATAGG - Intergenic
909615246 1:77601543-77601565 TTCAAAATCAACCTTTCTATTGG - Intronic
909933418 1:81524471-81524493 GTGAAAAACTACATATATATAGG + Intronic
910342110 1:86200185-86200207 GTGAAACCCAGCATTTAGATTGG - Intergenic
910702490 1:90091205-90091227 GTCAAAGACAACATTAATATAGG - Intergenic
910869974 1:91824518-91824540 ATGAAAATAAACATTTGAATGGG - Intronic
911472461 1:98335093-98335115 GTCAAAAGCAAAATCTATATGGG + Intergenic
911802041 1:102153680-102153702 GTGAAAAACAATTTTTGTATGGG + Intergenic
911922860 1:103789133-103789155 GTGATTATTAACATTTATTTAGG + Intergenic
911995776 1:104764327-104764349 GTGAAAATACACCTTCATATGGG - Intergenic
912000426 1:104827063-104827085 GTGTAAAACAACTTTAATATAGG + Intergenic
912164660 1:107029116-107029138 GTGAAATTTAGCATTTATAAAGG + Intergenic
912325628 1:108757945-108757967 TTCAAAATGAACATTTATCTAGG - Intronic
914566419 1:148871663-148871685 GTGACAATTATCATTTATGTTGG + Intronic
914606400 1:149258577-149258599 GTGACAATTATCATTTATGTTGG - Intergenic
917954992 1:180086113-180086135 GAGAAAATAAACATTTAAACAGG + Intronic
919384752 1:196907269-196907291 GGAAAAATCAACAGTTTTATTGG - Intronic
919405565 1:197177759-197177781 GGTAAAATCAACACTTATTTTGG - Intronic
919519110 1:198565138-198565160 CAGAAAAACAACATATATATTGG - Intergenic
920932058 1:210398176-210398198 ATGAAAATCAACATTTTAGTGGG + Intronic
921183832 1:212653266-212653288 GTATAAATCTACATTTATAGAGG + Intergenic
921536548 1:216355802-216355824 CTGAAAATCAAAATTTACTTAGG - Intronic
921824424 1:219656197-219656219 GTGAGAATCAACATTCATTGTGG - Intergenic
921916808 1:220622365-220622387 GTCAAAATAAACACTTTTATGGG - Intronic
923289974 1:232535352-232535374 GTGAAAATAGAGATTTATAATGG - Intronic
1063537187 10:6894865-6894887 TTGAAAATTAAAAATTATATGGG + Intergenic
1066213572 10:33264257-33264279 GTGAAATAGAACATTTATAAAGG + Intronic
1066274930 10:33859449-33859471 GTGAAATTCATCAGTTAAATGGG - Intergenic
1066307991 10:34165820-34165842 ATGAAAATGACCATTGATATGGG - Intronic
1066673668 10:37865357-37865379 GATAAAATTAACATTTAAATTGG + Intergenic
1067930882 10:50561164-50561186 GGAAAAATCAACATTTCTCTGGG + Intronic
1069084918 10:64127700-64127722 CTGCAAAGCAGCATTTATATTGG - Intergenic
1069586232 10:69604585-69604607 GTTAAAATAAAAATTTAAATAGG + Intergenic
1070268272 10:74926070-74926092 GTCAAATTCAACAATTATAGAGG - Intronic
1070452812 10:76578941-76578963 GAGAAGATCAACATTGCTATTGG + Intergenic
1070871765 10:79760814-79760836 GTGAAAATTAATATGTATTTAGG - Intergenic
1071080540 10:81804829-81804851 GAGAAGATCAACATTTATGTAGG - Intergenic
1071638686 10:87282981-87283003 GTGAAAATTAATATGTATTTAGG - Intergenic
1071656554 10:87454971-87454993 GTGAAAATTAATATGTATTTAGG + Intergenic
1073356921 10:102862600-102862622 ATGTAAATCAAAATTTATATTGG - Intronic
1075236054 10:120729884-120729906 CTGAAAATAAACATACATATGGG - Intergenic
1075849004 10:125571480-125571502 GTGAAAAGCATCATTTCTCTTGG - Intergenic
1077821752 11:5751779-5751801 ATGAAAATCAACTTATATTTAGG - Intronic
1077945772 11:6896505-6896527 GTGAAAAACAATATATGTATAGG - Intergenic
1078385275 11:10885545-10885567 CAGAAATTCAACATTTATTTGGG + Intergenic
1078636546 11:13055689-13055711 GGGAAAATCAACATTTCAAAGGG - Intergenic
1079033969 11:17006702-17006724 ATGAAGTTCAACATTTATCTAGG + Intronic
1079478830 11:20859585-20859607 GCGAATATCAAAATTTATATTGG - Intronic
1079725758 11:23878896-23878918 AAGAAAATCAAATTTTATATTGG + Intergenic
1082683797 11:56212736-56212758 GGGAATTTCAACATTTCTATGGG + Intergenic
1082843558 11:57709422-57709444 GTGGAAATCAAGAGTTATTTTGG - Intronic
1086035305 11:82407589-82407611 GTGAAAATAAATATTTATCATGG - Intergenic
1087292611 11:96336566-96336588 GTGAACATAAACATATATAAGGG + Intronic
1087473173 11:98602949-98602971 TAAAAAATGAACATTTATATTGG - Intergenic
1088144674 11:106662038-106662060 GAGAAATTCAAAACTTATATGGG - Intergenic
1088353329 11:108914142-108914164 ATGTAAATAAACATTTATATTGG + Intronic
1088493811 11:110412991-110413013 ATGAAAATCAACTTTTTCATTGG + Intergenic
1093026574 12:14250940-14250962 CTGAAAATCAAAAATTATCTGGG + Intergenic
1093203131 12:16214206-16214228 CTGAAAATCTAAATTTTTATTGG - Intronic
1093737676 12:22640125-22640147 TTTAAAAACAACATCTATATTGG - Intronic
1094507292 12:31072845-31072867 GTGGAATGCAACATTTTTATGGG + Intergenic
1095974915 12:47933543-47933565 ATGAAAAGCAAGATTTATCTAGG + Intronic
1097361029 12:58657952-58657974 GTGAAAATCATCAACTATCTGGG - Intronic
1097392946 12:59038126-59038148 GTGAATAAAAACATTTTTATTGG + Intergenic
1099599520 12:84715210-84715232 GGGAAAAAGAACATTTATTTAGG + Intergenic
1100271347 12:93028392-93028414 GTGAATATCGACATGGATATAGG + Intergenic
1101235452 12:102784545-102784567 GTGGAGATAAACATTTACATGGG + Intergenic
1103886168 12:124202261-124202283 GTGAAAAACAATAATTATAAGGG + Intronic
1104201094 12:126590042-126590064 ATGCAAATCTGCATTTATATTGG - Intergenic
1104521210 12:129476956-129476978 GTGACAACCAACTTTTATAAAGG + Intronic
1106778453 13:33031548-33031570 TCTAAAATGAACATTTATATAGG + Intronic
1107056087 13:36105222-36105244 GTGAAAAGCCACATTTACAAAGG + Intronic
1107594618 13:41950282-41950304 ATGAATAGCAACATTAATATAGG + Intronic
1108226254 13:48292910-48292932 GAGAAAATCAACATTGACCTTGG - Intergenic
1108647376 13:52443877-52443899 GTTAAAAGCAAGATATATATTGG + Intronic
1108706706 13:52995225-52995247 GTGAAAAACAACATTTGTAAGGG + Intergenic
1108741601 13:53344362-53344384 TTTAAAATCCAAATTTATATTGG - Intergenic
1108819018 13:54322728-54322750 GTATATATCAACATTTACATTGG + Intergenic
1109294807 13:60517025-60517047 GTGAGAATTAGTATTTATATTGG + Intronic
1109771387 13:66978264-66978286 CTGAAAATTATCATTTAAATTGG - Intronic
1109895431 13:68681324-68681346 GGAAAAATCAAAATATATATAGG - Intergenic
1109936826 13:69298087-69298109 GAGAAAATCTACTTCTATATAGG + Intergenic
1109992306 13:70074147-70074169 CTGAATATCAAAATTTTTATGGG - Intronic
1110186371 13:72680193-72680215 GTTAAAATCACCATTTATCATGG + Intergenic
1110296285 13:73870133-73870155 GGGAAAATGAGAATTTATATTGG - Intronic
1110749598 13:79097260-79097282 AAAAAAATTAACATTTATATAGG + Intergenic
1111073695 13:83204727-83204749 ATGAAATTCTACTTTTATATGGG + Intergenic
1111159583 13:84376843-84376865 TTGAAAATAAACATGTTTATAGG - Intergenic
1111256178 13:85671736-85671758 GTTAAAAACAACGGTTATATAGG - Intergenic
1112496134 13:99906380-99906402 GTGAAAATCAGAATTTGAATGGG + Intergenic
1112667338 13:101590803-101590825 GTTAAAATCATTATTTATATAGG + Intronic
1112747947 13:102549078-102549100 GTCAAAATCAACATCTACAATGG - Intergenic
1113730021 13:112634876-112634898 GGGAAAATATATATTTATATAGG - Intergenic
1114178716 14:20346823-20346845 GAAAAAATCAACATTAGTATAGG - Intronic
1115128145 14:30021284-30021306 GTGAAATGCAACTTTCATATTGG + Intronic
1115984262 14:39087530-39087552 TAGAAAATCAAGATGTATATAGG - Intronic
1117568583 14:57022352-57022374 AAGAAAATCAAGATTTATAGTGG + Intergenic
1118618731 14:67595271-67595293 GTGAAAAACAATGTTTGTATGGG + Intronic
1119943414 14:78665922-78665944 GAGAAAATCAACCTAGATATGGG - Intronic
1120041276 14:79755874-79755896 GTGAAAATCAGGATTTGCATAGG - Intronic
1125168628 15:36740586-36740608 CTGAATATCAAAATTTTTATGGG + Intronic
1125531705 15:40417879-40417901 GAAAAAAACAACATATATATGGG + Intronic
1126244577 15:46489328-46489350 TTGAAAATCAGCATTTAGACGGG + Intergenic
1126428328 15:48553475-48553497 GTGACATTCAACCTTTAAATAGG + Intronic
1126941773 15:53774945-53774967 GTGAAAAGTAACATTTAGACAGG + Intergenic
1130673468 15:85932642-85932664 GATAAAATTAACATTTAAATTGG - Intergenic
1134271325 16:12735733-12735755 GTAATAACTAACATTTATATAGG - Intronic
1135200400 16:20432249-20432271 ATTAAAATCAACATTTCTGTTGG + Intronic
1137772994 16:51032658-51032680 ATGAAAAACAATATTTATATCGG - Intergenic
1138259580 16:55605785-55605807 GAGAAGATTAACATTTAAATCGG - Intergenic
1138925305 16:61583112-61583134 TTGAAAATCATCATGCATATGGG - Intergenic
1139100030 16:63754518-63754540 GTGAACTTCAATATTTAAATGGG - Intergenic
1139453828 16:67055112-67055134 GTGAAAGTCAGAATTTATCTTGG + Intronic
1140553046 16:75888072-75888094 GAGATAATAAACATTTTTATCGG + Intergenic
1141292395 16:82731618-82731640 ATGGCAATCAACATTGATATGGG + Intronic
1143990513 17:10956315-10956337 GTGATATTCAACATTTCTAAAGG - Intergenic
1144380018 17:14685601-14685623 GTGAAAAGCCACATTGACATAGG - Intergenic
1145048781 17:19642697-19642719 GTGGACACAAACATTTATATTGG + Intergenic
1148878791 17:50709079-50709101 GTGAGAATTAAAATTTAAATTGG - Intergenic
1148924478 17:51072011-51072033 TTTAAAATAAACATTTATTTAGG - Intronic
1150234978 17:63585678-63585700 GTGAAGATCAACATCTCCATGGG + Intronic
1150570983 17:66387163-66387185 GTGAAAAGGAACATTAATCTAGG - Intronic
1150986459 17:70203283-70203305 GTCAAAATAAATATTTTTATTGG + Intergenic
1151513835 17:74579582-74579604 CAGAAAAACAACATTTCTATGGG - Exonic
1153266111 18:3271271-3271293 AAGAAAATTAACATTTATTTAGG + Intronic
1153485090 18:5590009-5590031 GTGAAAATTAAAATTTGAATCGG + Intronic
1153553436 18:6285522-6285544 GTGAAAGTCATCATATAAATTGG + Intronic
1154960972 18:21308341-21308363 GTTAAAATAAAAATTTATAATGG - Intronic
1155859078 18:30873788-30873810 ATGTAAAATAACATTTATATTGG - Intergenic
1156429422 18:37055511-37055533 GGGAAAATGAACATTTATTTGGG + Intronic
1157800259 18:50614558-50614580 GTGAAACTGATCCTTTATATTGG - Intronic
1158039066 18:53070468-53070490 GTGAAATTGAACATCTATAATGG - Intronic
1158066798 18:53420281-53420303 GTGAAAAGGAAGATCTATATAGG - Intronic
1159836951 18:73349008-73349030 ATGAACATAAACATTCATATAGG + Intergenic
1162670295 19:12251466-12251488 GTGAAAATGAACACTTCTCTGGG - Intronic
1163871173 19:19822431-19822453 GAGAAAATCAACTTTTACTTTGG + Intergenic
1163875147 19:19861538-19861560 GAGAAAATCAACTTTTACTTTGG + Intergenic
1163884954 19:19957164-19957186 GAGAAAATCAACTTTTACTTTGG + Intergenic
1163934054 19:20425269-20425291 GAGAAAATCAACTTTTACTTTGG + Intergenic
1163938542 19:20472807-20472829 GAGAAAATCAACTTTTACTTTGG - Intergenic
1163958035 19:20661912-20661934 GAGAAAATCAACTTTTACTTTGG + Intronic
1163977226 19:20863659-20863681 GAGAAAATCAACTTTTACTTTGG + Intergenic
1164774692 19:30843891-30843913 TTGAAAATAAACATTTTTTTAGG + Intergenic
1166630695 19:44404394-44404416 CTGAAAATCCACACTTAAATGGG + Intergenic
925740858 2:7004911-7004933 GTGAGCATCAACATTTTTTTTGG - Intronic
925940910 2:8817038-8817060 GTTAAAATCAACTTTTAAAAGGG + Intronic
928190592 2:29162435-29162457 AAGAAAATTAACATTTAAATGGG + Intronic
929164815 2:38871135-38871157 TTAAAAATCCACATTTATATTGG + Intronic
929217112 2:39426095-39426117 ATCAAAATCAACATTAATAAGGG + Intronic
929241050 2:39653805-39653827 ATGATAATCAACATATAGATGGG - Intergenic
929860123 2:45669708-45669730 GTGAAAATTAAAATGTATATCGG + Intronic
930568381 2:53052455-53052477 GTGAAAGTCAACTTTTCTTTGGG - Intergenic
930906993 2:56581958-56581980 GTGATAATCTACATTGAAATGGG - Intergenic
931053961 2:58447486-58447508 GTGAACATTAACATATATAATGG - Intergenic
933895023 2:86803067-86803089 TTAAAAATCAACATTTACTTTGG + Intronic
935093419 2:99918938-99918960 ATGAAAATCAACTTTTCTGTGGG - Intronic
937179514 2:119978652-119978674 GTGTAAAATAACATTTGTATAGG - Exonic
937710177 2:124971783-124971805 GTGTCAATGAACATTTCTATTGG + Intergenic
938090720 2:128432673-128432695 GAAAGATTCAACATTTATATCGG - Intergenic
938176209 2:129132913-129132935 GAGAAAATCAAATTTTACATTGG - Intergenic
938243123 2:129758305-129758327 GTCAAAATTTACATTTAAATAGG - Intergenic
939161108 2:138589904-138589926 TTAAAAATCAACATTTTTGTAGG + Intergenic
939413310 2:141859982-141860004 ATGAAAATGAACATATAAATGGG - Intronic
939686144 2:145203043-145203065 ATGAAAATGAACATTTTCATTGG + Intergenic
940954044 2:159708990-159709012 GGGAAAATAAAAATTTATAAAGG + Intergenic
941096942 2:161247923-161247945 TTAAATATCAACATTTTTATAGG + Intergenic
942221911 2:173777405-173777427 GTTACAATAAACATATATATGGG - Intergenic
943838517 2:192547473-192547495 TTGAAAAGCAACCTTTGTATTGG + Intergenic
943900499 2:193428270-193428292 GTGAAAGTGAACATTTATATTGG + Intergenic
943933368 2:193883332-193883354 TTGAAAAACAACATTTGTGTGGG + Intergenic
946056609 2:216908215-216908237 GGGAACATGAAAATTTATATGGG + Intergenic
946384284 2:219372959-219372981 ATGGAAATAAACTTTTATATAGG + Intergenic
946572227 2:221036720-221036742 CTGAAAATCCAAATTTATACAGG - Intergenic
946708533 2:222483510-222483532 CTGAAAATTTACATTTAAATTGG + Intronic
947328732 2:229005678-229005700 GTTAAAATAGACCTTTATATTGG + Intronic
1170252943 20:14305658-14305680 GTGAAAAAGAAAATTTATTTGGG - Intronic
1171172815 20:23030943-23030965 TTGAAAATAAAAATTTAAATGGG - Intergenic
1172389565 20:34557940-34557962 CTGAAGATCAACATTTTTTTGGG - Intronic
1172729861 20:37077368-37077390 GATGAAATCAACATTTAGATTGG + Intronic
1173018428 20:39247543-39247565 GTGAAAATCACCGTTTCTCTGGG + Intergenic
1173284758 20:41660212-41660234 GGGAAATTCAACATTTAGATGGG - Intergenic
1173368949 20:42417365-42417387 ATGAAGAACAACATATATATAGG - Intronic
1174694309 20:52542047-52542069 CTGAAAATGGCCATTTATATTGG - Intergenic
1174746709 20:53070730-53070752 GTTCACATAAACATTTATATAGG + Intronic
1177732249 21:25042569-25042591 GAGAAAGTCAACATTTAATTGGG - Intergenic
1177936890 21:27359852-27359874 GTGAAAATCAACATCAAAACAGG + Intergenic
1181863568 22:25837852-25837874 ATGAAAAACAACATTTTCATGGG - Intronic
1183934373 22:41253777-41253799 CTGTAAATAGACATTTATATTGG + Intronic
949661200 3:6281038-6281060 ATGAAACTGAAGATTTATATGGG + Intergenic
951263965 3:20546195-20546217 GTGAAACTAAATATTTATGTGGG + Intergenic
951375708 3:21913525-21913547 GTTGAAATCCACTTTTATATTGG - Intronic
952213881 3:31256204-31256226 GTCAAAGTCAATATTTCTATGGG - Intergenic
953294378 3:41698607-41698629 GGGATAATCAACCTGTATATAGG + Intronic
953309807 3:41865425-41865447 TTGAAAATAGACATTTCTATTGG - Intronic
953385530 3:42503766-42503788 GAGAAAATCAACCTTTGTCTAGG - Intronic
955563701 3:60221935-60221957 GTGCATACCCACATTTATATAGG - Intronic
955608263 3:60730318-60730340 GTGATATTCACCATTGATATTGG - Intronic
956110414 3:65864855-65864877 GGGAAAATCAATATTTTTAAAGG + Intronic
956983892 3:74673918-74673940 GTGAGAATTAAAATTTATATAGG + Intergenic
957659007 3:83121995-83122017 GTGAATATGGATATTTATATAGG - Intergenic
957767516 3:84645646-84645668 GTGAAAATCAAATTTTAGCTTGG + Intergenic
957946800 3:87074311-87074333 GAAAAAATAAACATTTAAATTGG - Intergenic
958990954 3:100844415-100844437 GTAAAAATCCACATTGATTTGGG - Intronic
959508752 3:107184759-107184781 GCTAAAATCAAGATTTAAATAGG + Intergenic
961196639 3:125007433-125007455 AGGGAAATCAACATTTAAATTGG - Intronic
962029910 3:131588953-131588975 CTTAAAATCAAAATGTATATAGG + Intronic
963016451 3:140828568-140828590 GAGAAAAGCAACATGTTTATGGG - Intergenic
963524229 3:146396096-146396118 TTGAAAATCTACTTTTAGATAGG - Intronic
963693835 3:148539832-148539854 ATGAAAATCAATATTTATGTAGG + Intergenic
963883799 3:150557226-150557248 GAGAAAATCAAGATTTAAGTAGG + Intronic
963909343 3:150801898-150801920 GTTAAAATCATAATTTAGATAGG + Intergenic
964321128 3:155498329-155498351 GAGAAAAACAACATATATATAGG + Intronic
964935943 3:162087577-162087599 ATGATAATCTACATTTATTTTGG - Intergenic
965461083 3:168964215-168964237 CTGAAAATAAACCTTTTTATTGG - Intergenic
968416323 4:437555-437577 GTGAAAATTAACAGATATACAGG + Intronic
970557121 4:17245366-17245388 GTGAAAAAAAACGTATATATTGG + Intergenic
970802333 4:19988328-19988350 AAGAAAATCATCATTTATAGAGG - Intergenic
970808736 4:20065896-20065918 GTAACAATCAACATTTATGTAGG + Intergenic
971662274 4:29434761-29434783 TCGAAAATCAACATTTACTTTGG + Intergenic
971699051 4:29944480-29944502 ATGAAATTCAACATTTAAATTGG - Intergenic
972127054 4:35781134-35781156 GTCATAATAAACATTTCTATTGG + Intergenic
972958577 4:44423006-44423028 GTAAATTTCAACATTTATTTAGG + Intronic
973793273 4:54397554-54397576 GTGAAAATCCACATTTGTGGTGG + Intergenic
974361821 4:60890662-60890684 GTGAACATCAACACTTCTAATGG + Intergenic
975286468 4:72627324-72627346 ATAAAAGACAACATTTATATTGG + Intergenic
975300729 4:72787816-72787838 TTGAAAATCCACATTTCCATAGG + Intergenic
976888826 4:90019552-90019574 GTGGAAATCATCATTTGTTTTGG + Intergenic
976905766 4:90234160-90234182 CTGAAATTTAACATTTATCTGGG + Intronic
977351942 4:95899391-95899413 GTGAAAATTAACATTTCTAAGGG - Intergenic
977542588 4:98335754-98335776 CTTAAAATCAACATTAATCTTGG - Intronic
977661802 4:99597003-99597025 GTGAACATCCACATTTACAAAGG - Intronic
978074014 4:104506732-104506754 GTGAAAATCAACAATGCTCTAGG - Intergenic
978380239 4:108119938-108119960 GTGAACATAAATATTTTTATAGG + Intronic
979078835 4:116309060-116309082 TTCAAAATAAACATTTATACTGG + Intergenic
981323113 4:143416046-143416068 GTTAAACTGAATATTTATATTGG - Intronic
982403114 4:154990443-154990465 GTGAAAATCCATATTTAGAGTGG + Intergenic
982576736 4:157120673-157120695 ATAAAAATGAACATTTATATGGG - Intronic
983764973 4:171468226-171468248 GTTAATGTCAACATTTATTTTGG + Intergenic
984649545 4:182255458-182255480 GTTAAAATCAACACTTACAGAGG + Intronic
988959421 5:36354732-36354754 CTTAAAAGCAACATTTATTTTGG + Intergenic
990356252 5:54969075-54969097 GTGAAAACCAAGATGTATTTAGG - Intergenic
990651741 5:57907946-57907968 GTGGAAATCAACATTCACCTGGG + Intergenic
990855112 5:60256886-60256908 GTGAAATTCAACATGAATTTTGG - Intronic
991507185 5:67337557-67337579 TTTAGAAACAACATTTATATAGG + Intergenic
993909063 5:93658858-93658880 GTTAAAATAAAGATTTTTATAGG - Intronic
994351819 5:98754658-98754680 GAGTAAATAAACATTTATATAGG - Intergenic
994423633 5:99556601-99556623 GAATAAGTCAACATTTATATTGG + Intergenic
994431776 5:99674537-99674559 CTGAAAAACAATATTTATTTAGG - Intergenic
994958906 5:106572413-106572435 TTTAAAATCAACATTTTAATAGG - Intergenic
996801655 5:127410319-127410341 GTGAAAATAAACAGTTAATTTGG - Intronic
997687229 5:135796962-135796984 GTGAAAACCACCCTTGATATTGG - Intergenic
998782035 5:145668426-145668448 TTTAAAATCTAGATTTATATTGG - Intronic
999541396 5:152576826-152576848 GGGAAAACTAACATCTATATAGG + Intergenic
1000106919 5:158068530-158068552 GAGAAAATCAATATTTATATTGG + Intergenic
1000480817 5:161771610-161771632 GAGAAAGGCAAAATTTATATTGG - Intergenic
1001176481 5:169473722-169473744 GTGAAAATCATCAATTTTAGTGG + Intergenic
1001616507 5:173047424-173047446 GGAAAAAGCAACATTTAGATGGG - Intergenic
1003387433 6:5682261-5682283 GTAAAAATATACATTTGTATTGG + Intronic
1003798440 6:9632680-9632702 GTGAAAAGCAATAGTTGTATGGG - Intronic
1003966935 6:11261456-11261478 ATGAAAATCAACAGAAATATGGG - Intronic
1005586596 6:27282651-27282673 GTTAAAATTAACATTTAGGTTGG + Intergenic
1005704053 6:28433957-28433979 CTATAAATCTACATTTATATAGG + Exonic
1006123837 6:31824719-31824741 AAGAAAAACAGCATTTATATTGG + Intergenic
1006750767 6:36375440-36375462 GTTAAAATCAAAAGTCATATTGG + Intronic
1007078742 6:39084294-39084316 TTGAAAATCACCATATTTATTGG - Intronic
1007446207 6:41908114-41908136 CTGAGGATCAACATTTATGTAGG - Intronic
1007579130 6:42945498-42945520 GAGAAAATCCACATATATGTGGG + Intergenic
1007676137 6:43596611-43596633 CTTAAAATCCACATTAATATTGG - Intronic
1008157516 6:48034769-48034791 GTGAAAAGCAAAATTTTCATTGG - Intronic
1008606790 6:53148045-53148067 TTGAAAATCAACATTCAGTTGGG - Intronic
1009516393 6:64624347-64624369 ATGATAAACAAAATTTATATGGG + Intronic
1010634337 6:78239240-78239262 CTGAAAAACCACATTTATAGGGG + Intergenic
1010834232 6:80567128-80567150 GTGGAAAACAAAATTAATATTGG + Intergenic
1010986463 6:82430866-82430888 GATAAAATTAACATTTAAATTGG - Intergenic
1011141508 6:84162926-84162948 GAGAAAATCAAGAATTATTTTGG - Intronic
1011206137 6:84900709-84900731 GTATAAATCTATATTTATATAGG + Intergenic
1012301593 6:97595311-97595333 GTCAACAACAACCTTTATATTGG + Intergenic
1012645696 6:101677869-101677891 GTGAAAATCAACATTTATATTGG - Intronic
1013530152 6:111011696-111011718 CTGACAATAAACAATTATATGGG - Intronic
1013828691 6:114246688-114246710 CTCAAAATCAAGTTTTATATTGG + Intronic
1015055078 6:128891580-128891602 TTGAAAATGAACATTTATTGAGG - Intronic
1015262216 6:131251181-131251203 GTGGAATTCAACATTCATTTAGG - Intronic
1016613000 6:146014375-146014397 GTGAAGATGCACCTTTATATAGG + Intergenic
1021382884 7:19989557-19989579 ATTAAAATCATCATTTATGTTGG - Intergenic
1021568660 7:22041045-22041067 ATGGAAATCTACATTTCTATGGG - Intergenic
1022188367 7:27992239-27992261 GTGAAAACCAATATTTATAAGGG - Intronic
1022335917 7:29421844-29421866 GAGAAAATCACAATATATATGGG - Intronic
1022584733 7:31596751-31596773 GTGTAGATGAATATTTATATTGG + Intronic
1023356317 7:39370706-39370728 GATAAAATTAACATTTAAATTGG + Intronic
1024082935 7:45870523-45870545 GTGGACATCAATATTTATATTGG + Intergenic
1024532257 7:50403126-50403148 GTGCAAAGAGACATTTATATTGG - Intronic
1026609347 7:71843806-71843828 GAGGAAATTAACATTTATAGAGG - Intronic
1027603077 7:80263671-80263693 TTGCAAATCAAAATTTATCTGGG - Intergenic
1028531855 7:91847089-91847111 TTGAACATATACATTTATATAGG + Intronic
1028705368 7:93838432-93838454 GTGACAATAAAAGTTTATATTGG + Intronic
1029835250 7:103302465-103302487 GTGAAAATCCTCCTTTATGTGGG - Intronic
1029837164 7:103324942-103324964 GTGAATATTAACATTTTTAAAGG - Intronic
1030778018 7:113560897-113560919 GTGAAAAAACAAATTTATATTGG + Intergenic
1031028582 7:116710068-116710090 GTGAAAAACACCAATTACATTGG + Intronic
1032981462 7:137288683-137288705 ATGGAAATAAACATTTATTTGGG + Intronic
1033910949 7:146262528-146262550 GTACAAATCAAAATTTCTATTGG + Intronic
1036908909 8:12735411-12735433 GTGAAAACTAACATGTATCTTGG - Intronic
1037005566 8:13775564-13775586 GTGATAATCATGATTTATAATGG - Intergenic
1037848920 8:22309770-22309792 ATAAAAACCTACATTTATATAGG - Intronic
1038916470 8:32030205-32030227 GTGAAAGTTAACATTTGTAGTGG + Intronic
1039655656 8:39402552-39402574 TTGTAAACCCACATTTATATAGG - Intergenic
1040767204 8:50927130-50927152 GAGAAAATCAATGTTAATATTGG - Intergenic
1041789679 8:61679254-61679276 GTGAATATCAAGGTTTATTTTGG - Intronic
1042280572 8:67051999-67052021 AAGGAACTCAACATTTATATGGG + Intronic
1042746728 8:72116305-72116327 GGGAAAATTGACACTTATATTGG + Intronic
1044040759 8:87365734-87365756 TTTAAAATTAACATTAATATGGG + Intronic
1044373255 8:91439489-91439511 GTGAAATTTAAGATTTAAATTGG - Intergenic
1044483866 8:92726428-92726450 ATGAAAATCTAAATTTATAAAGG - Intergenic
1044642685 8:94401203-94401225 GTGAAAGTCCACTTATATATGGG + Intronic
1046279713 8:112010243-112010265 GTGAAAAACAACATATATTTAGG + Intergenic
1046423214 8:114011742-114011764 ATGAAAATCAACATGTTTAAAGG + Intergenic
1047238400 8:123062633-123062655 GTGAAAAACAATGCTTATATGGG - Intronic
1047396387 8:124503062-124503084 GTGAAATTATATATTTATATAGG + Intronic
1048548583 8:135411122-135411144 GAGAAAATCTACATTTCTTTGGG - Intergenic
1050241942 9:3645851-3645873 GTGAAAATGATCTTTTATTTTGG + Intergenic
1051885465 9:21888071-21888093 GTGAAAAGCAACAATCATTTAGG + Intronic
1051970629 9:22882839-22882861 ACTAAAATCAACTTTTATATAGG - Intergenic
1052103793 9:24485867-24485889 GTGATAAGTAAGATTTATATAGG - Intergenic
1052135372 9:24902966-24902988 GTAAAAAACACCATATATATAGG + Intergenic
1052561982 9:30095470-30095492 ATGAAAATCGACATTTAAAATGG - Intergenic
1052797319 9:32935034-32935056 TTGCAAATAAACAATTATATTGG + Intergenic
1053447446 9:38163962-38163984 GTAAAAATCAACTTTAATACGGG - Intergenic
1055535322 9:77236793-77236815 CAGAAAATCTACATTAATATGGG - Intronic
1055724583 9:79213683-79213705 GGTAATATCAACATTTAAATTGG - Intergenic
1057593565 9:96395006-96395028 GAGAGAATCAGCCTTTATATAGG + Intronic
1057639868 9:96808971-96808993 GTGAAAATAAAGCTTTATAGGGG + Intergenic
1058497158 9:105571366-105571388 GTGAAAAGGAACATTTTGATAGG + Intronic
1060302709 9:122384632-122384654 GTGAAAATCAAGATTCAGAGAGG + Intronic
1186375600 X:8995979-8996001 GTTAAAAGCCACATTGATATGGG - Intergenic
1188167356 X:26878234-26878256 GTGAAAATCAGCACTTTTCTAGG - Intergenic
1188609101 X:32073774-32073796 GTTTAAATCAGAATTTATATAGG - Intronic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1191157409 X:57288795-57288817 GTAATAGTTAACATTTATATAGG - Intronic
1192423960 X:71059547-71059569 GGGAACTTCAACATTTAGATGGG + Exonic
1192445891 X:71210896-71210918 GTCATAAACAATATTTATATTGG + Intergenic
1194776169 X:97967865-97967887 ATGTAAATCAACATTTATAATGG + Intergenic
1195300659 X:103526916-103526938 GATAAGATCAACATTTAAATTGG + Intergenic
1196004948 X:110825932-110825954 GTGAAATTTAACATGTATATAGG + Intergenic
1196688542 X:118533444-118533466 TTGAAAATCAACCTTGATAGGGG - Intronic
1198615491 X:138453921-138453943 CTCAAGATCAACATTTATTTAGG - Intergenic
1200665797 Y:6020719-6020741 GTTAAAATAAACTTTTATACAGG - Intergenic