ID: 1012646460

View in Genome Browser
Species Human (GRCh38)
Location 6:101689748-101689770
Sequence GTGTGGGAATGGAGAAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 550
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 498}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012646460 Original CRISPR GTGTGGGAATGGAGAAAAGT GGG (reversed) Intronic
902261180 1:15226067-15226089 GGGTAGCACTGGAGAAAAGTAGG + Intergenic
902410117 1:16207449-16207471 GTGTGGAAACGGGGAAAAGAGGG - Intronic
902795248 1:18796592-18796614 TTGTTGGAATGGCCAAAAGTTGG + Intergenic
902870297 1:19310238-19310260 GTGGGGAAATGGAGAAAATCTGG - Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903994846 1:27299370-27299392 CTGTGGGCATCAAGAAAAGTTGG + Intronic
903999574 1:27331185-27331207 GTGTGGCCATGGAGAAGAGGGGG + Intronic
904307599 1:29600144-29600166 CTGTGGGAAAGGAGAAAATGGGG + Intergenic
904947027 1:34206849-34206871 GTGAAGGAGTGGACAAAAGTGGG + Intronic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
906199612 1:43950998-43951020 TTTTGTGAATGGAGGAAAGTAGG + Intronic
908427898 1:64026134-64026156 GAGTGAGAATGAAGACAAGTTGG - Intronic
908816595 1:68041822-68041844 CTGTGGGAATGGAGAAAGACAGG - Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909705506 1:78579022-78579044 GGGTGGGAATAAAGAAATGTAGG - Intergenic
910024830 1:82637651-82637673 GGGTGGGAAGGGAAAGAAGTGGG + Intergenic
910064134 1:83132652-83132674 TGGTGGAAATGGATAAAAGTGGG - Intergenic
910860800 1:91740968-91740990 GTGTGAGCATAGAGAAAAATAGG - Intronic
912228793 1:107768028-107768050 GTGGAGGAATGGAGGAAAGTAGG + Intronic
912865467 1:113252410-113252432 AAGTGGTAATGGAGATAAGTGGG + Intergenic
912872410 1:113321194-113321216 GTGTGAGAACAGAGAAAAGGGGG - Intergenic
912976256 1:114333390-114333412 GAGGGAGAATGTAGAAAAGTGGG - Intergenic
913991702 1:143619060-143619082 GTGTGGGAATGTAGAGCAATGGG - Intergenic
915013587 1:152712777-152712799 GAGTGGGAATGGAGGTAAGGAGG + Intergenic
915196458 1:154193504-154193526 GTGTGGGAATGGGAGAGAGTTGG - Intronic
915460119 1:156065398-156065420 GTGTGGGTAAGGAGAAAGTTTGG - Intronic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915916086 1:159941828-159941850 CTGTGGGAATGGATGAAAGCGGG - Intronic
916242320 1:162652491-162652513 GTCTGGGAATGTAGAAAACTGGG - Intronic
916328491 1:163590637-163590659 GTGGGGGAATCGAGAGATGTTGG - Intergenic
916478490 1:165193135-165193157 GTAGGGGAATGAAGAGAAGTTGG + Intergenic
916748520 1:167703274-167703296 GGGTGGGAAAGGGGAAAAGGAGG - Intronic
916752391 1:167734884-167734906 ATATTGGAATGGAGAAATGTGGG - Intronic
916993936 1:170275398-170275420 GTGTGGGAATTTAGAAAATGGGG - Intergenic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917679865 1:177354850-177354872 GTCTGAGAATGGAGAAAATTGGG + Intergenic
917894443 1:179474265-179474287 GTGTGAGAATGGAGTAATATAGG + Intronic
917982242 1:180277254-180277276 GTTTGGAAATGGAGAAAAGCCGG + Exonic
918298808 1:183183629-183183651 AGGTGGGAACTGAGAAAAGTTGG + Intergenic
919595745 1:199559991-199560013 GTGGGGGGATGGAGAGAGGTTGG + Intergenic
920277598 1:204819044-204819066 GCATGGAAATAGAGAAAAGTTGG + Intergenic
920301437 1:204991494-204991516 GTTTGGGAAGGGGGGAAAGTGGG - Intronic
921204821 1:212839682-212839704 GCTTGGGAATGGGGAAAGGTAGG + Intronic
921947139 1:220894075-220894097 GTTAGGGAATGGAGTAAAGAGGG - Intergenic
922201788 1:223409229-223409251 GGGTGGAAATGGAGGAAAGTGGG + Intergenic
922410130 1:225365483-225365505 GGGTGGGCATGGAGAAAATCAGG + Intronic
922697497 1:227738373-227738395 GTGAAGGAATGTAGAAAAGCCGG - Intronic
922776408 1:228216084-228216106 GAGGGGGAAAGGAGGAAAGTGGG - Intronic
923552459 1:234974934-234974956 GTGTGGCTATGGGGATAAGTGGG + Intergenic
924077325 1:240353876-240353898 GGCAGGGAATGGAGAAAAGCAGG + Intronic
924753239 1:246917185-246917207 GTGACCGAATAGAGAAAAGTGGG + Intronic
1063267387 10:4468867-4468889 GTGTGGGAATGAAGAGCTGTTGG - Intergenic
1063744012 10:8858838-8858860 TTGTGGGAATGAAGAACATTTGG - Intergenic
1063806975 10:9656473-9656495 GTGAGGAAAAGGAGAAAATTTGG - Intergenic
1064691103 10:17919256-17919278 GTTTTGTGATGGAGAAAAGTCGG - Intergenic
1065029127 10:21567514-21567536 CTGTGTCAGTGGAGAAAAGTAGG - Intronic
1065281621 10:24144861-24144883 GTGAGGGGAGGGAGAAAGGTGGG - Intronic
1065287405 10:24199442-24199464 GTGTGGCAATGTGGAAAGGTGGG - Intronic
1065438144 10:25722445-25722467 GTGTTGGTATGGCGAAAATTTGG - Intergenic
1065636224 10:27737676-27737698 GTGTGTGAAAGGAGCAAAGAAGG - Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065846887 10:29751907-29751929 ACGTGGGCATGGAGAATAGTGGG + Intergenic
1067399717 10:45959954-45959976 GTGAGGAACTGGAGAAAAGATGG - Intergenic
1067659320 10:48222528-48222550 GTGTGGGAAGTTGGAAAAGTAGG + Intronic
1067678537 10:48409466-48409488 GACTGGGAATGAAGAAAACTGGG + Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1067868045 10:49929248-49929270 GTGAGGAACTGGAGAAAAGATGG - Intronic
1068133966 10:52932069-52932091 AGGTGGGAATGGAGAAAAAAGGG + Intergenic
1068738219 10:60438848-60438870 CTGTGGGGAGGGAGAAAAGCAGG + Intronic
1071090405 10:81911710-81911732 GTGTGGTAACGGGGAAAGGTTGG - Intronic
1071346777 10:84701008-84701030 GGGTGGGAAGGGAGAACAGAGGG + Intergenic
1071479778 10:86056529-86056551 GTTTGGGAATGGGGACAGGTGGG - Intronic
1071706946 10:88009414-88009436 AAGTGGGGATAGAGAAAAGTAGG + Intergenic
1072010618 10:91299863-91299885 GTGTGGCAATTGAGAACACTGGG - Intergenic
1072216226 10:93289493-93289515 GTGGGGAAATGGCCAAAAGTTGG - Intergenic
1073119138 10:101111009-101111031 GGGTGGGGGTGGAGAAAAGTAGG + Intronic
1073183373 10:101600366-101600388 TTCTGGTAATGGAGAAAATTTGG - Intronic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1073821792 10:107272678-107272700 GACTGGGAAAGGAGAGAAGTTGG - Intergenic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1074541799 10:114371289-114371311 GTGATGGAAAGGAGAAAGGTGGG + Intronic
1074595282 10:114858730-114858752 GAGGAGGAATGGAGAGAAGTTGG + Intronic
1074918975 10:117988076-117988098 GTATGGAAATAGAGAAAAGAAGG - Intergenic
1075188890 10:120287826-120287848 GGGTGGGAAAGGAGAAATGGAGG + Intergenic
1075245155 10:120815069-120815091 GTGTGGTAAGGGAGAAAGCTGGG - Intergenic
1076282004 10:129254330-129254352 TTCAGGGAAAGGAGAAAAGTAGG + Intergenic
1076922705 10:133463437-133463459 GTGGGGGAATGGGGAGATGTAGG - Intergenic
1077014591 11:394004-394026 TTGTGGGATGGGAGAAAAGGAGG + Intronic
1077020984 11:417107-417129 CTGGGGGAAGGGAGGAAAGTGGG - Intronic
1077086236 11:752876-752898 GGGTGGGAATGGAGAATGGTTGG + Intronic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1078394649 11:10969931-10969953 GTGAGGGAATGGGGACAAATTGG + Intergenic
1078659147 11:13272063-13272085 GTGTGGTAATGAAGTAGAGTAGG + Intergenic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079133446 11:17762811-17762833 GGGTGGGAATGGAGAGACGAAGG - Intronic
1079152509 11:17913248-17913270 GTGTGGGGCTGGAAGAAAGTGGG - Intronic
1079545171 11:21625379-21625401 TTCTGGGCAGGGAGAAAAGTGGG - Intergenic
1079548056 11:21659154-21659176 GTGGGGAAATGGAGAGATGTTGG + Intergenic
1079998461 11:27321093-27321115 GAGAGGGAAGGAAGAAAAGTTGG - Intergenic
1080747371 11:35120265-35120287 GGGTGGAAGAGGAGAAAAGTTGG + Intergenic
1081237747 11:40665980-40666002 GTGTGTGAATGTAGAAAGTTTGG + Intronic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1082822706 11:57555015-57555037 GTGAGGAAATGGAGAAAATGAGG + Intronic
1083731518 11:64654917-64654939 CTGAGGGAATGGATAACAGTAGG + Intronic
1083783936 11:64933267-64933289 GTGGGGGAAGGGAGAAGAGCAGG + Intronic
1084097092 11:66918708-66918730 GTGTGGGTATAGAGATAAGTAGG + Intronic
1084734592 11:71096331-71096353 GTGTGGGGATTGAGACCAGTTGG + Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1086052953 11:82615636-82615658 TTGTTGAAATGGAGAAAACTAGG - Intergenic
1086904474 11:92403284-92403306 GTGTGGGAACTTAGAAGAGTGGG - Intronic
1087079037 11:94152122-94152144 GGGTGGGAAGGGAGAATGGTAGG + Intronic
1087605548 11:100373224-100373246 GTGGGAGGATGAAGAAAAGTTGG - Intergenic
1088168847 11:106971606-106971628 ATATGGTAATGGAGTAAAGTTGG + Intronic
1088513752 11:110605077-110605099 GTATAGGAATGTAGAAAAGAAGG + Intronic
1089751660 11:120655742-120655764 GTGTGGGAACAGAGAAATCTAGG + Intronic
1090073951 11:123567545-123567567 TTGTAGGAAGGGGGAAAAGTGGG + Intronic
1091505049 12:1059373-1059395 GAGTAAGAATGGTGAAAAGTTGG + Intronic
1091569180 12:1669626-1669648 GAATGGGAATGGGGAGAAGTAGG + Intergenic
1092131988 12:6119209-6119231 GTGCGGGACTGGAGGAGAGTAGG - Intronic
1094069802 12:26400819-26400841 GTGTGGGAACGGAGCAGAATTGG - Intronic
1096592429 12:52669778-52669800 GTGTGGGAATGGGAAAAGGTGGG + Intergenic
1096670464 12:53195565-53195587 TTGGGGGAATTGAGAAAGGTTGG + Intronic
1096861564 12:54532430-54532452 GTAGGGGGATGGAGAGAAGTGGG + Intronic
1097168641 12:57099577-57099599 CTGTGGGAACGGAGACTAGTGGG - Intronic
1097314216 12:58154892-58154914 GTGTGGGAATGGATATTAGGGGG - Intergenic
1097454624 12:59782541-59782563 ATGTGGGAATAGAGATTAGTGGG - Exonic
1097731949 12:63138447-63138469 GTGTGGCAATGGATTAGAGTTGG - Intergenic
1097880674 12:64683464-64683486 GTGTGGGGAGGTAGAGAAGTGGG + Intronic
1097967344 12:65595348-65595370 GTGGGGGGATGGGGAGAAGTAGG - Intergenic
1099039959 12:77640409-77640431 GGATGGAAATGGAGAGAAGTAGG - Intergenic
1099640766 12:85280566-85280588 GAGGGAGAAAGGAGAAAAGTGGG + Intronic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1100497283 12:95137810-95137832 CAGTGGAAATGGTGAAAAGTAGG - Intronic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1101361709 12:104033500-104033522 GTGGGGAAATGGGGAAATGTCGG + Intronic
1101709997 12:107256413-107256435 TTGTGGGAATGGGGAAAACAGGG + Intergenic
1101784404 12:107870302-107870324 GAGAGGGAATGGAGAGACGTAGG + Intergenic
1101932979 12:109030105-109030127 GTGTGGGAAAGGTATAAAGTAGG - Intronic
1102097347 12:110250967-110250989 CTGTGAGAGTGGAGAAATGTTGG - Intergenic
1102396780 12:112592780-112592802 GTCTGGGAATGGAGAAGTGCCGG - Intronic
1103179266 12:118894518-118894540 GTGGGGGAAGGGAGAACATTAGG + Intergenic
1104345626 12:127994051-127994073 GTGTGGGACAAGAGAAAAGCAGG - Intergenic
1104622703 12:130330410-130330432 GCCTGGGAAAGGAGCAAAGTCGG + Intergenic
1105889946 13:24675543-24675565 TTGGGGGAATGGAGAGATGTAGG + Intergenic
1106340594 13:28823045-28823067 GTTGGGGAAGGGAGGAAAGTGGG + Intronic
1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG + Intergenic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1110009274 13:70311386-70311408 GAGTGTCAATGGAGAGAAGTTGG - Intergenic
1110011932 13:70347060-70347082 ATGTGGGAAGGTAAAAAAGTTGG + Intergenic
1110035971 13:70684365-70684387 GTGTGGGAGTGGGGAAGAGGAGG + Intergenic
1110823160 13:79939989-79940011 ATGTGGGAGTGAAGAAAAGAAGG + Intergenic
1111202526 13:84959281-84959303 GTGGGGGAATGGAGAGATGTTGG - Intergenic
1111522670 13:89426633-89426655 ATGTGAGAATGGAAATAAGTTGG - Intergenic
1111705880 13:91748938-91748960 GTGTGTGAATAGAGAGAAGGGGG + Intronic
1112203125 13:97297488-97297510 GGGTGGGAATGGGTAAGAGTGGG + Intronic
1112287040 13:98113358-98113380 GTGAGGGAATAGAGAACAGTGGG - Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112542551 13:100329949-100329971 GTGTTGTTATGGAGAAAAATTGG - Intronic
1113449238 13:110394848-110394870 TTGTGGGAGTGGAGAAAATTAGG - Intronic
1114546641 14:23507777-23507799 GTTTGGGAATAGGGAAGAGTGGG - Intronic
1114757417 14:25275573-25275595 GTGTGGCAAAGCTGAAAAGTGGG - Intergenic
1115300238 14:31877224-31877246 GGGTGGGAAAGAAGAAAAGTTGG - Intergenic
1115590260 14:34857520-34857542 GTGTGGGAAAGGAGAAATCATGG - Intronic
1115708025 14:36018012-36018034 GTTTGGATATGGAGAAAACTAGG - Intergenic
1116159927 14:41254613-41254635 GCATGGGAATGGAGAAATGGAGG + Intergenic
1116825940 14:49673482-49673504 TTGTGGAAATGGGGAAAAGGTGG - Intronic
1120848506 14:89147490-89147512 GTGGGGGAATGGATAAAAGAGGG + Intronic
1121377552 14:93428168-93428190 GTGAGGAAATGGAGAAATGGAGG + Intronic
1121403309 14:93701968-93701990 GTGAGGGACTTGAGAAGAGTAGG - Intronic
1122149104 14:99715008-99715030 GTGGGGGGATGAAGAGAAGTTGG + Intronic
1123962145 15:25414739-25414761 ATGTGAGAATGTAGAAATGTAGG - Intronic
1124555719 15:30723935-30723957 GTGTAGGAATGGAGCAATGAAGG + Intronic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1126599019 15:50410138-50410160 GTATATGAATGGAGAAAAATGGG - Intergenic
1128200796 15:65805405-65805427 ATGTAGGAATGGAGAAAATGTGG - Intronic
1129306397 15:74667197-74667219 ATGTGGTAATGGATTAAAGTTGG + Intronic
1129601377 15:77000562-77000584 GTGGGGAAATGGAGAAAAATAGG + Intronic
1130418553 15:83717541-83717563 GTAAGGGAAGGGAGAAAAGAAGG + Intronic
1130519070 15:84648440-84648462 GGGTGGGAATGGAGATGAGGAGG + Intronic
1130573357 15:85068715-85068737 GTGAGGGGCTGGAGAAAATTTGG + Intronic
1130620352 15:85455270-85455292 GAGTGGGAGTGGGGAAGAGTTGG + Intronic
1130684670 15:86026203-86026225 CCGTGGGAAAGGAGAAAAATGGG + Intergenic
1130765967 15:86871553-86871575 GAGTGAGGAAGGAGAAAAGTCGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1132026248 15:98406504-98406526 GTGTGGTGACGGAGACAAGTAGG - Intergenic
1133730950 16:8578104-8578126 GTGTGAGGATGCAGAAAAATAGG + Intronic
1133732117 16:8586900-8586922 GTGTGGGAGTTGAGGAAAGGTGG - Intronic
1134296392 16:12949998-12950020 AGGTGGAAATGGGGAAAAGTTGG - Intronic
1134892054 16:17849620-17849642 GTATGGGATTGGGGAAATGTTGG + Intergenic
1135353217 16:21747930-21747952 GTTTGGCTATGGAGAAAAGATGG - Intronic
1135451704 16:22564053-22564075 GTTTGGCTATGGAGAAAAGATGG - Intergenic
1135706066 16:24676143-24676165 GTGAGCAAATGGAGATAAGTGGG - Intergenic
1136004646 16:27320446-27320468 GTGCAGGAATGGAGATGAGTGGG + Intronic
1136928604 16:34397879-34397901 GGCTGGGAATGGAGCAATGTTGG - Intergenic
1136975970 16:35013925-35013947 GGCTGGGAATGGAGCAATGTTGG + Intergenic
1137066968 16:35856931-35856953 GTGTGCGAATGATCAAAAGTTGG - Intergenic
1137642304 16:50043273-50043295 GTGGGGCAAAGGAGAAATGTGGG + Intergenic
1137784448 16:51126296-51126318 GGGTGGGAATGAAAAAAAGGTGG + Intergenic
1138190545 16:55010272-55010294 GTTTGGGTATGAAGAAAAGGTGG + Intergenic
1138807854 16:60112451-60112473 GGATGGGAATGAAGAGAAGTGGG - Intergenic
1138871022 16:60886135-60886157 GTGTGGGAATGGATAAACTGTGG - Intergenic
1138969224 16:62124344-62124366 GTGTGGGGAGGGAGAACATTAGG + Intergenic
1139197029 16:64931182-64931204 GGGTGGAAATGGGGAGAAGTAGG + Intergenic
1139327647 16:66164599-66164621 GTGTGAAAAGGGACAAAAGTGGG - Intergenic
1140867304 16:79074493-79074515 GTGGGGGAATGGAGAGACCTGGG + Intronic
1142591714 17:1009186-1009208 GTGGGGGAATGGACAGCAGTGGG - Intronic
1143023405 17:3928110-3928132 GTGTCGGGCTGGAGAGAAGTGGG - Intronic
1144025877 17:11275264-11275286 GCGTGGGAATGGGGCAAGGTTGG + Intronic
1145271988 17:21409725-21409747 GTGTAGGAATTGAGACAGGTGGG + Intronic
1145310194 17:21697188-21697210 GTGTAGGAATTGAGACAGGTGGG + Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146994204 17:37303934-37303956 TTGTGAGAATGCAGAAAAATTGG - Intronic
1147031966 17:37645759-37645781 ATGTGTGAATGGAGAAGAGAAGG + Intergenic
1147160867 17:38568854-38568876 GTGTCTGAATGGAGCAGAGTGGG + Intronic
1148924283 17:51068976-51068998 GAGTGGGAAAGTAGAAAATTAGG - Intronic
1149751752 17:59153420-59153442 GTGTGGGGTTGGAGAAGTGTAGG - Intronic
1150179819 17:63106121-63106143 GTGTAGGATTGGAAAAAAGGGGG + Intronic
1150260158 17:63782662-63782684 CTGTGGGAAAGGAGAAACGGGGG - Intronic
1151396538 17:73826773-73826795 GTGGGGGAATGGGGAGGAGTCGG + Intergenic
1151768647 17:76145502-76145524 GTGTGAGAACGGAGAGAAGCAGG + Intronic
1153271733 18:3329389-3329411 GAGTAGGATTGGAAAAAAGTGGG - Intergenic
1153545851 18:6204150-6204172 GTGTGGCAATAGAAAAAAGGAGG - Intronic
1153894526 18:9546303-9546325 GTGTGGGATTTGAGAATAGGTGG - Intergenic
1154339703 18:13492771-13492793 CTGTGGGGATGGAGAAAATGAGG - Intronic
1155559487 18:27060511-27060533 GAGTGGGAATGTTGAAAAGAGGG + Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155980142 18:32171264-32171286 GTGAGAGAAAGGAGAAAGGTAGG - Intronic
1156092051 18:33483097-33483119 GTGTGTGTATGTGGAAAAGTTGG - Intergenic
1156853806 18:41758307-41758329 GCTTTGGAATGGACAAAAGTAGG + Intergenic
1158106866 18:53895372-53895394 GTGTGGGAAAAGAGGCAAGTCGG + Intergenic
1158499424 18:57986850-57986872 GAGTGGGACTGGAGAAAAAGGGG - Intergenic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1159485726 18:69054897-69054919 TAGTGGGAATAGAGAAAATTAGG + Exonic
1159730892 18:72026202-72026224 GTGTGGGACTGGAGGAAGGTGGG - Intergenic
1159970600 18:74647751-74647773 GTGTGGGCATGGTGACAAGGTGG + Intronic
1161218957 19:3109187-3109209 GTGTGAGGGTGAAGAAAAGTGGG + Intronic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1161970853 19:7579283-7579305 GTGTGGGAAGGCAGGAAAGAGGG - Intergenic
1165843522 19:38803686-38803708 GAGTGGGAATGGTGAGAATTGGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1168296416 19:55379186-55379208 GGGTGGGAATGGAGACGAGGTGG - Intergenic
925383437 2:3444930-3444952 GTGTTGAAATGTAAAAAAGTTGG - Intronic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
927185148 2:20477013-20477035 GTGTGGGAAAGAAAAGAAGTTGG + Intergenic
927249923 2:20988373-20988395 GGGTGGGAGAGGAGAAAAGAGGG + Intergenic
927257893 2:21056263-21056285 GTGCGGCAGTGGAGAAAGGTTGG + Intergenic
928114901 2:28539696-28539718 GTGCTGGAAAGGAGAGAAGTGGG + Intronic
928144198 2:28757041-28757063 GGGAGGGAATGGAGAGAAATGGG - Intronic
928785875 2:34885487-34885509 TAGAGGGAATGGAGGAAAGTGGG - Intergenic
929444769 2:41993026-41993048 GTGCGGGGAGGGAGAAAAGATGG - Intergenic
930926694 2:56826832-56826854 ATGTGGGCATGGAGAAATGTTGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
933613987 2:84464873-84464895 GTCTGGGAATGCAGCACAGTAGG + Intergenic
933679216 2:85084307-85084329 GGGTGGGGTGGGAGAAAAGTAGG + Intergenic
934745885 2:96759539-96759561 GTGCGGGAAGGGAGTAAAGTGGG + Intergenic
935116441 2:100140908-100140930 GTTTGGGAAAGGTGAAAGGTGGG - Intronic
935141360 2:100355710-100355732 GTGTGGGAAGGGATTAAAATTGG + Intergenic
935324768 2:101926004-101926026 GTGTGAGAATGGACTAATGTAGG + Intergenic
936584459 2:113741831-113741853 GCCAGGGAATGGAGAAAAATGGG + Intronic
936912272 2:117605110-117605132 GTGTAAGAATGGAGAGAAGGGGG + Intergenic
937038615 2:118803383-118803405 GGGTGGGAATGGAGCAAGGATGG - Intergenic
937131372 2:119516564-119516586 GGGTGGGAATGGAGAGATATAGG + Intronic
937556050 2:123157456-123157478 GTGTGTGAATGGAGAATTTTAGG + Intergenic
937701118 2:124863939-124863961 ATGTGGGAATGGAAAATAATTGG - Intronic
938730975 2:134146907-134146929 GTATGGCTATGAAGAAAAGTAGG + Intronic
939070722 2:137538248-137538270 GTGTGGAAATAGAGAACACTTGG - Intronic
940750723 2:157624597-157624619 ATGTAGGATTGGAGAAAACTAGG + Intronic
941749017 2:169116247-169116269 GGGTGGGAATGGAGGAGTGTGGG - Intergenic
942700132 2:178698233-178698255 TTGAGGGAATGGGGAAATGTTGG + Intronic
942828553 2:180210517-180210539 TAGTGGGAAGAGAGAAAAGTAGG + Intergenic
944377024 2:199057497-199057519 GTGTGCAAAGGGAGAAAACTGGG + Intergenic
944570644 2:201041569-201041591 GTGTTGGAATGGAAAATACTGGG - Intronic
944768837 2:202891912-202891934 GTGAGGAAATGGGGAAATGTTGG + Intronic
945265571 2:207888340-207888362 GTGTGTGTATGAAGAAAAGCAGG - Intronic
946343368 2:219087069-219087091 GAGTGGGAGTAGAGAAAAGAAGG - Intronic
946612726 2:221476752-221476774 GTGGGATAATGGAGAACAGTGGG - Intronic
946640359 2:221777361-221777383 GGGTGGGAAGGGGCAAAAGTGGG + Intergenic
947040429 2:225912174-225912196 GAGTGGGAATGGACAGCAGTGGG - Intergenic
948171900 2:235910512-235910534 GGGTGGGAAGAGAGAAAAGAAGG + Intronic
1168864989 20:1078689-1078711 GGGTGGGAACAGAGAAGAGTAGG - Intergenic
1169135640 20:3195486-3195508 TTGGGGGAATGGAGAAATGGGGG - Intronic
1169418451 20:5438735-5438757 GTGTGGGAAGGGAGAGCATTGGG - Intergenic
1170064501 20:12296055-12296077 GTGTGGGAATGAAGAGAGATTGG - Intergenic
1170537885 20:17359472-17359494 GTGTGGGAATGGAGCTCAGATGG - Intronic
1172323139 20:34012696-34012718 GGGTGGGAATGGAGAAGAAGAGG - Intronic
1172323421 20:34015801-34015823 CTGTAGGGATGGGGAAAAGTAGG - Intronic
1172798903 20:37562897-37562919 GTCTGGGAATGCAGACCAGTAGG + Intergenic
1173285008 20:41662377-41662399 AAGTGAGAATGGAGAAAAATGGG + Intergenic
1173464552 20:43270681-43270703 GTGAGGGAGGGGAAAAAAGTAGG + Intergenic
1174547905 20:51339909-51339931 GGGTGGGAATGGGGAAAAAGTGG - Intergenic
1175337277 20:58204901-58204923 GTATGGGATTGGAGCAAAGTGGG - Intergenic
1179229666 21:39489997-39490019 ATGAGGGTATGGAGAAAAGAAGG + Intronic
1179993131 21:44958892-44958914 GTGTTGGAATGAAGAAAACGAGG - Intronic
1180730795 22:17980625-17980647 TTGTGGCAACGGAGAAAAGGAGG + Intronic
1180871205 22:19148333-19148355 GTGTGGGAGTGGAGCCAAGGTGG + Intergenic
1181592309 22:23893049-23893071 TTCAGGGAATGGAGAGAAGTGGG + Intronic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1184292885 22:43507545-43507567 GTGTGCGGGTGGAGAAAAGCAGG + Exonic
949564509 3:5232375-5232397 GTGTGGGGATGGGGAAGCGTGGG + Intergenic
951140005 3:19148106-19148128 GTGTGGTATTGGAGAAAGGGAGG - Intergenic
952028575 3:29113145-29113167 GAGTGATAATGGAGAAAAGCTGG - Intergenic
952054931 3:29432820-29432842 GAATGGGAAGGGTGAAAAGTTGG + Intronic
952400547 3:32959450-32959472 GTGGGGCAGTGGAGCAAAGTAGG + Intergenic
952740742 3:36731798-36731820 GTGAGGGGAGGGAGAAAAGAAGG - Intronic
952844215 3:37673416-37673438 GTGTGAGATTGGAGAAAGGGAGG + Intronic
953500382 3:43427275-43427297 GGGTGGGGATTGATAAAAGTGGG + Intronic
954167813 3:48774566-48774588 GTGGGTGGATGAAGAAAAGTTGG - Intronic
955153908 3:56396900-56396922 CTGTGGGAGATGAGAAAAGTGGG - Intronic
955607128 3:60717141-60717163 GTGTGGGAGAGGAAAAAAATGGG + Intronic
955688788 3:61570044-61570066 GTGTGGTAATGGAGGGAAATAGG + Intronic
956145224 3:66185112-66185134 GTCTGGGAAAGGAAAAAAGAGGG - Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956725694 3:72154905-72154927 GTGGGGGCATGGAGAGAAGCAGG - Intergenic
957228636 3:77481851-77481873 GTATTGGAAAGGAGAAAACTGGG + Intronic
959284392 3:104389784-104389806 GGGAGGGAATGGAGAAATGGAGG + Intergenic
960255786 3:115510104-115510126 ATGTGGGAATGAAGAAACGAAGG + Intergenic
960354564 3:116635457-116635479 GCGTGGGAATGTAAAAAAATTGG + Intronic
960447404 3:117764997-117765019 GTGTGGGAAGGGAGAGCATTAGG - Intergenic
960905076 3:122592448-122592470 GTGGGGGAAGGGAGAACATTAGG + Intronic
961522765 3:127476749-127476771 AAGAGGGAAGGGAGAAAAGTAGG + Intergenic
961668693 3:128510666-128510688 ATGTGGGAATGGTGAAGGGTGGG - Intergenic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962730006 3:138273310-138273332 GTGTAGGAGTGGAGAATAGGGGG - Intronic
962743315 3:138379156-138379178 GTGGGGGGATGAAGAGAAGTTGG - Intronic
962996313 3:140632451-140632473 GATTGGGAATGGAGAAGTGTAGG + Intergenic
963960303 3:151302666-151302688 GAATGGGTATGAAGAAAAGTAGG - Intronic
964764765 3:160169318-160169340 GTGTGGGAATGGGGAGGAATAGG - Intergenic
965262188 3:166501053-166501075 GTGTTGGGATGGCGAAAATTTGG + Intergenic
965388228 3:168071739-168071761 GTGAGGGAGTGGAAAAATGTAGG + Intronic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
966299006 3:178458009-178458031 TTGTTGTAATGGGGAAAAGTTGG - Intronic
966316843 3:178656895-178656917 GGGTGGTAAAGGAGACAAGTAGG + Intronic
966591478 3:181688294-181688316 GTATGGGAAAGGAGAGAAATGGG + Intergenic
966666721 3:182479856-182479878 GAGTGGGAGTGGGGAAAAGGGGG + Intergenic
967442335 3:189523295-189523317 GAATGAGAATGGTGAAAAGTAGG - Intergenic
967699402 3:192573937-192573959 GGCTGGGAAAGGAGAAAACTGGG - Intronic
967944182 3:194789342-194789364 GGGTGGGAATGAAGAAAGGTTGG - Intergenic
968853566 4:3101606-3101628 GTGTGTGTATGGTGAAAACTAGG + Intronic
969242133 4:5906209-5906231 ATGTTGGCATGGAGAGAAGTGGG + Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969622265 4:8284529-8284551 GTGTGGGCATGGAGGCCAGTGGG + Intronic
969682947 4:8653226-8653248 TTGAAGGAATAGAGAAAAGTGGG - Intergenic
969854260 4:9986340-9986362 TTCTGGAAATGGACAAAAGTTGG + Intronic
969875502 4:10133067-10133089 GTGTGGGGATGGACACAAGGTGG + Intergenic
970574886 4:17417580-17417602 TTGTGGGAAAGGGTAAAAGTAGG - Intergenic
970638948 4:18041823-18041845 TGGTGGGAATGGAGTAGAGTAGG + Intergenic
970950439 4:21749488-21749510 GTCTGGGAATGGTGTCAAGTGGG - Intronic
971129073 4:23785937-23785959 AAGTGGGAAAGAAGAAAAGTTGG + Intronic
971738528 4:30490199-30490221 GTGTTAAAATTGAGAAAAGTTGG - Intergenic
972196076 4:36655518-36655540 GTGTTTGAATGGAGAAATGTAGG + Intergenic
972415713 4:38838595-38838617 GTGAGGGAATGAAGAGAGGTTGG + Intronic
972740278 4:41881428-41881450 TTGTGGGAAAGGACAAAAGCAGG - Intergenic
973824309 4:54689871-54689893 GTGTGGGGAGGGAGTACAGTGGG - Intronic
974376576 4:61085463-61085485 GTGTGGGGATGGAGGAATTTTGG - Intergenic
974390421 4:61259678-61259700 GTGTGAGAAAGGAGGAAAGCAGG + Intronic
974758289 4:66242332-66242354 GTGCTGGAATGGAGAAAAGTTGG - Intergenic
975845860 4:78524593-78524615 ATTTAGGAATAGAGAAAAGTAGG + Intronic
976829236 4:89295188-89295210 GTGTGAGAATGGAAAAAAGGGGG - Intronic
977268667 4:94887076-94887098 GAATGGGAAAGGAGAAAAGAAGG + Intronic
977427994 4:96893156-96893178 GTGAGGGAAAGAAGAAAAGCAGG - Intergenic
977801522 4:101239669-101239691 GGGTGTGACTGGAGAACAGTTGG - Intronic
977889383 4:102290784-102290806 CTGTGGGGTTGGGGAAAAGTGGG - Intronic
977969887 4:103200950-103200972 TTGTGGCAATGGAGAGAGGTAGG + Intergenic
978119326 4:105059592-105059614 GGGTGGGAATGGGGAGAAGAGGG + Intergenic
979076775 4:116280910-116280932 GTGTGGGAATGTAGTAAAGTAGG + Intergenic
979083695 4:116378160-116378182 GTGAGAGAATGGAGAACAGTTGG - Intergenic
979962418 4:127036691-127036713 GTCTGGGAGTGGAGCAAAGAGGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980949122 4:139354742-139354764 ATATGGGAGTAGAGAAAAGTAGG - Intronic
981255450 4:142656208-142656230 GGGTGAGAATGGAGAAAAGTGGG - Intronic
981723330 4:147823380-147823402 GTGTGGAAAGGGAGAGAACTTGG + Intronic
983249107 4:165325461-165325483 GTTTGGGCAGAGAGAAAAGTTGG + Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984194976 4:176648357-176648379 GTGTGGGAGGGGAGAAAATAAGG + Intergenic
984556927 4:181225686-181225708 GTGTGGGGAGTGAGAAAAGAAGG - Intergenic
985614067 5:909057-909079 GGGTGGGATAGGAGAGAAGTGGG - Intronic
986353436 5:6902195-6902217 GGATGGGAAAGGAGAAGAGTGGG + Intergenic
986372392 5:7092943-7092965 AGGTGGGAATGGGGAAAAGGAGG + Intergenic
986981152 5:13449384-13449406 ATGTGGGCATGGGAAAAAGTTGG - Intergenic
987066610 5:14296117-14296139 GTGTGGGAAGTGAGAGAAGGGGG + Intronic
987938460 5:24501037-24501059 TTGTTGCTATGGAGAAAAGTGGG + Intronic
988631926 5:32940696-32940718 GTGGTGGAATGGAGAATATTTGG - Intergenic
989352415 5:40501359-40501381 AGGAGGGATTGGAGAAAAGTAGG - Intergenic
990033589 5:51292017-51292039 GTGGGGGCAAGGGGAAAAGTTGG + Intergenic
990320330 5:54623618-54623640 GTGTGGGAATGGAGAAGACTTGG - Intergenic
990783474 5:59393531-59393553 AGGTGTGAATGGAGAAAGGTAGG - Intronic
991106249 5:62845578-62845600 GAAGGGGAATGGAGAAAAGTTGG - Intergenic
992879428 5:81091412-81091434 GTGTGGGATTGGGGAACAATGGG - Intronic
993218536 5:85059137-85059159 ATTTGGGAATGGGGAAAAGTGGG + Intergenic
993355564 5:86902990-86903012 TAGTGGAAAAGGAGAAAAGTGGG - Intergenic
993656947 5:90589476-90589498 GTGTGGAATGGAAGAAAAGTGGG + Intronic
993661401 5:90640795-90640817 GTGTGGGAAGGGGAAAAAGGAGG - Intronic
995397625 5:111704140-111704162 GTGTGGGGATTGGGAAAAGATGG + Intronic
995768434 5:115644105-115644127 GTCTGGGGATGGATAAAAATAGG + Intergenic
995903314 5:117094250-117094272 GTGTGGGGATGGAGAAACTGAGG - Intergenic
996207546 5:120760232-120760254 ATGTTGTAATGGATAAAAGTTGG + Intergenic
997221388 5:132168842-132168864 GTCTGGGAATGGAGAGTAGTTGG - Intergenic
997625591 5:135328689-135328711 GCCTGGGAATGGAGAAAGGAGGG - Intronic
999664957 5:153903338-153903360 CTCTGGGAATGGAGAAAGATGGG + Intergenic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
1001371197 5:171204468-171204490 GTGTGAGAAAGGAGAAAATCTGG + Intronic
1002168367 5:177361868-177361890 GTGAGTGAATGGAGAAAAAGGGG - Intronic
1002791611 6:441488-441510 GTGTGGGAATGGAGGGCTGTGGG - Intergenic
1003077548 6:2996563-2996585 GCGTGAGAATGTAGAGAAGTTGG + Intronic
1003576096 6:7296722-7296744 GTGAGGGAATGGGGAAGAGGAGG + Intronic
1004735214 6:18399219-18399241 GGGTGGGAATGGGGAGATGTTGG - Intronic
1007543589 6:42672797-42672819 GGGTGGGAAAGGAAGAAAGTGGG - Intronic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1007925406 6:45645994-45646016 GGGTGGGAGTGGAGACCAGTAGG + Intronic
1008653924 6:53591749-53591771 GTGGGGGAATGAAGAGAAGTTGG - Intronic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009481791 6:64168304-64168326 GGGTGAGAATGTAGAGAAGTGGG + Intronic
1009600914 6:65797973-65797995 GTGTGGGGATGGAGCAAAATTGG + Intergenic
1009859575 6:69309832-69309854 GTGTGGAAAAGAAGATAAGTAGG + Intronic
1012053801 6:94379100-94379122 GTGTTCGAATGGTGAAAAGCAGG - Intergenic
1012143790 6:95656141-95656163 AAGTGGGGATGGAGAAAAGGTGG - Intergenic
1012453701 6:99381391-99381413 GTTTGGAAAGGGAGAAAACTGGG - Intronic
1012570638 6:100723568-100723590 GTGTGGAAATGTAAAGAAGTAGG - Intronic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1013060869 6:106632590-106632612 TGGTGAGGATGGAGAAAAGTTGG - Intronic
1014820223 6:125981076-125981098 GGGTGGGAAAGGACAAAAGCAGG - Intergenic
1015062664 6:128985703-128985725 CAGTGGGAAAGGAGAACAGTTGG - Intronic
1015510222 6:134031040-134031062 GAGTGGAACTGGAGATAAGTAGG + Intronic
1016520388 6:144940320-144940342 GAGAGGCAATGGAGAAAAGCAGG - Intergenic
1016800499 6:148164126-148164148 ATCAGGGATTGGAGAAAAGTAGG - Intergenic
1016854236 6:148650381-148650403 GTGGAGGAATGGAGAAAAACAGG + Intergenic
1017557804 6:155591274-155591296 AGGTGGGAATGAAGAGAAGTTGG - Intergenic
1018291632 6:162297990-162298012 GTGTGAAAATGGAGAATAATAGG - Intronic
1018598120 6:165506077-165506099 TTATGGGAATGGAAAAAAGCGGG - Intronic
1019026839 6:168973012-168973034 GTGTGTGTATGGAGAAAAAAGGG - Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022981101 7:35605762-35605784 GTGTAGCAATGGGGAAAAGAAGG - Intergenic
1024317193 7:48032111-48032133 GAGTGGGAATGGGGAGATGTTGG + Intergenic
1026531044 7:71197576-71197598 GTGGGGGAGTGGAGGAAAGTGGG - Intronic
1026605920 7:71815778-71815800 GGGTGGGAAGGGAGGAAAGGGGG - Intronic
1027279980 7:76602092-76602114 TGGTGGAAATGGATAAAAGTGGG + Intergenic
1027529783 7:79315897-79315919 GAGTGGGAAAGGAGCTAAGTTGG + Intronic
1027538574 7:79438813-79438835 TTGGGGGAAAGGAGAAAATTTGG - Intronic
1028183990 7:87759337-87759359 GCAAGGGAAGGGAGAAAAGTCGG + Intronic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028860535 7:95645110-95645132 ATTTCGGAATGTAGAAAAGTGGG - Intergenic
1029846575 7:103418123-103418145 GTGTGGGGATGGTGAAGAGGAGG - Intronic
1030610344 7:111681821-111681843 GTGTGGTAATGACCAAAAGTTGG - Intergenic
1030704123 7:112673715-112673737 TTGTGGGATTAAAGAAAAGTGGG - Intergenic
1030731471 7:112994829-112994851 GTGTGGGAATGGGGAGATATTGG + Intergenic
1031031675 7:116742051-116742073 CTGTGTGCATGTAGAAAAGTTGG + Intronic
1031530133 7:122866055-122866077 GACTGGGAATGGGAAAAAGTGGG + Intronic
1031767000 7:125792469-125792491 CGGTGAGAATGGAGAAAAATTGG + Intergenic
1031810039 7:126356210-126356232 GTTGGGGGAGGGAGAAAAGTGGG - Intergenic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032317362 7:130851436-130851458 GTGTGGTAAAGGGGAAAAGGGGG - Intergenic
1032481827 7:132253544-132253566 TTGTGGGTATAAAGAAAAGTTGG - Intronic
1032703646 7:134403824-134403846 CTGTGGGGATGAAGAAATGTGGG + Intergenic
1032757082 7:134901422-134901444 GGGTGGGAATGGGGGAACGTAGG + Intronic
1032836253 7:135677595-135677617 GTGTGACTATAGAGAAAAGTAGG + Intronic
1033258572 7:139822694-139822716 GTGTGGGGATGAAGAAGAGGGGG - Intronic
1034313672 7:150111117-150111139 GTCTGGGGATGGAGAACACTGGG - Intergenic
1034740391 7:153468081-153468103 TTGAGGGGATGGAGAAAAGGTGG - Intergenic
1034793230 7:153989679-153989701 GTCTGGGGATGGAGAACACTGGG + Intronic
1034937563 7:155209852-155209874 GGGTGGGAATGGAGCAGGGTAGG - Intergenic
1035447482 7:158952673-158952695 GTGTGGACAGGGAGAAAAGGAGG + Intronic
1035447495 7:158952742-158952764 GTGTGGACAGGGAGAAAAGGAGG + Intronic
1036215759 8:6878442-6878464 TAGTGGGAAAAGAGAAAAGTTGG - Intergenic
1036507757 8:9370972-9370994 GTGGGGGAATGAAGAAAGGTTGG - Intergenic
1036579640 8:10061999-10062021 GTGGGGGAAGGGAGGAAAGGAGG + Intronic
1038556805 8:28525759-28525781 GTGTGGAAATGGAGATCAATTGG + Intronic
1038629234 8:29225172-29225194 GTGTGGGAAGGCAGAAAGGCAGG + Intronic
1039158719 8:34592956-34592978 GAGTGGCAATGGAGAGATGTTGG + Intergenic
1040362148 8:46676086-46676108 GTGGGGGAATGAAGAGAGGTTGG + Intergenic
1040445972 8:47494003-47494025 GTGAGGGGAAGGAGAAAAGAAGG - Intronic
1040949723 8:52925183-52925205 GGGTGGAAAGGGAAAAAAGTGGG - Intergenic
1041481007 8:58319829-58319851 GTGTTGGAATGGAGATAAGGAGG + Intergenic
1041536048 8:58926427-58926449 GAACGGGAATGAAGAAAAGTTGG + Intronic
1042099138 8:65255418-65255440 CTGTGGGACTGGAGAAAAAGAGG - Intergenic
1042487984 8:69367513-69367535 TGGTGGGAAGGGAGGAAAGTAGG - Intergenic
1043701620 8:83295202-83295224 GGGAGAGGATGGAGAAAAGTGGG - Intergenic
1043742901 8:83836496-83836518 ATGGAGGAATGGAGAAAATTAGG - Intergenic
1043755913 8:84003580-84003602 GTGTGGGCATGCACACAAGTAGG + Intergenic
1044613675 8:94118758-94118780 CTGAGGGGATGGAGAAAAATGGG + Intergenic
1045447356 8:102281115-102281137 GAGTGGCAATGGGGAAAGGTTGG + Intronic
1046551857 8:115728193-115728215 GAGTGTGGATAGAGAAAAGTAGG + Intronic
1047006507 8:120625458-120625480 GTGAAGGCATGCAGAAAAGTGGG + Intronic
1047702449 8:127462808-127462830 GTGTGGGAAAAGAGAAAAAAAGG - Intergenic
1048105791 8:131407807-131407829 GTGGGGGAATGGGGAGAGGTGGG - Intergenic
1048376687 8:133828718-133828740 CTTTGGTAATGGACAAAAGTGGG + Intergenic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048662126 8:136616762-136616784 GTGTAAGAATGGAGAAAAGGTGG - Intergenic
1048779349 8:137984677-137984699 GTGTGGGCAGAGAGAAAAGGGGG - Intergenic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049161011 8:141097640-141097662 GTGGGGGAATGAAGAGAGGTTGG - Intergenic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1051455477 9:17251868-17251890 GAGTGGGAATGTATAAAGGTTGG - Intronic
1051851851 9:21518655-21518677 GTGTGGAAATGTAGAGAATTTGG + Intergenic
1051972045 9:22900249-22900271 GTGTGGGAAAAGAGAAATGAAGG - Intergenic
1052162278 9:25279416-25279438 GTGTGGTATTGGTGAAAAATAGG + Intergenic
1052209314 9:25882896-25882918 GTGAGGAAATGGGGAGAAGTAGG - Intergenic
1052892829 9:33719959-33719981 GTGGGGGAAAGAAGCAAAGTGGG + Intergenic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1055100356 9:72457911-72457933 GTGAGGGAAAAGAGAAAATTAGG + Intergenic
1055176249 9:73321143-73321165 GTGTTGGAATGGAAAGAACTAGG - Intergenic
1055703451 9:78971811-78971833 GAGGGAGAATGGAGAAAAGAAGG + Intergenic
1056142738 9:83699089-83699111 GTGGGGGAATGGGGAAAATGGGG + Intronic
1057285891 9:93754018-93754040 ATGTGGGAATGGGAAAAAGGAGG - Intergenic
1057479502 9:95433747-95433769 GGGAGGGAAGGGAGAAAATTTGG - Intergenic
1057607949 9:96514948-96514970 GTCTGGGCAAGGAGAAAAGCAGG + Intronic
1057953594 9:99389379-99389401 GTGTGGGATTGGCCAAGAGTGGG - Intergenic
1058048673 9:100384501-100384523 GTCTGGGAATGGAGCCCAGTAGG - Intergenic
1058247289 9:102643190-102643212 GTCTGGGAATGCAGCACAGTAGG - Intergenic
1058287118 9:103192014-103192036 GGGTGGGAATGAAGAGAAGCTGG + Intergenic
1058301613 9:103380407-103380429 GTGTGGGAATGGTGTAGTGTGGG - Intergenic
1058366355 9:104213797-104213819 GGGTGGGAATGGGGAGAAGTTGG - Intergenic
1058593499 9:106589854-106589876 ATATTGGAATGGAGAAAAATAGG + Intergenic
1059924370 9:119193437-119193459 GAGAGGAAATGGAGAAATGTAGG + Intronic
1185984404 X:4815040-4815062 GTGGGGGAATGGGGAGATGTTGG - Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186458852 X:9732378-9732400 GGGTGGGAATAGAGAATTGTGGG + Intronic
1186729564 X:12394626-12394648 GTGAAGGAAGGGAGAAAAGGAGG - Intronic
1186906001 X:14111190-14111212 GGGAGGGAAAGGAGAAAAGTTGG - Intergenic
1188197454 X:27254859-27254881 GTGTGGGACTGGGGAGATGTTGG - Intergenic
1189271881 X:39757826-39757848 GTGTGGGGATGGTGGAAAGTAGG - Intergenic
1189901231 X:45708500-45708522 AGGGGGGAATGAAGAAAAGTTGG + Intergenic
1189913466 X:45834785-45834807 GTGGGGGGTTGGAGGAAAGTGGG + Intergenic
1190248199 X:48704684-48704706 GAGGGGGAATGGAGAAGAGACGG - Intronic
1191171431 X:57451338-57451360 GAGTGTCAATGGAGCAAAGTAGG - Intronic
1191878465 X:65820790-65820812 ATGTGGGGAGGGAGAAAAATTGG + Intergenic
1192911217 X:75606622-75606644 GTGTAGAACTGGATAAAAGTGGG + Intergenic
1196161776 X:112492901-112492923 GTGGGGTGATGGGGAAAAGTGGG - Intergenic
1196360035 X:114842513-114842535 GGTTGGGAATGGAGATACGTTGG + Intronic
1196871317 X:120116003-120116025 GAGAGGGAATGGAGAGGAGTGGG + Intergenic
1197129506 X:122988815-122988837 CTGTAGCAATGGAGAAAAGATGG - Intergenic
1198597814 X:138256175-138256197 GAGGGGGAGTGGAGAAAAGTAGG + Intergenic
1198635055 X:138688331-138688353 GAGGGGGAATGCAGCAAAGTTGG + Intronic
1198730472 X:139722512-139722534 ATTTGGGAATGGAGAAAGGAAGG + Intergenic
1198806857 X:140502217-140502239 GTCAGGGACTGGAGGAAAGTGGG + Intergenic
1198889340 X:141375790-141375812 GTGTGGGAATAGAGGATAGTAGG - Intergenic
1199853589 X:151742038-151742060 TAGTGGGAATGGAGAAAGTTTGG - Intronic
1199896012 X:152128286-152128308 GTTTGGGAAGGGAGGAAGGTGGG + Intergenic
1199916205 X:152343596-152343618 CTGTGTGAATGGAGAGAATTTGG - Intronic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1200015957 X:153164082-153164104 GTGTGGGAAGGGAGGAAGGTGGG - Intergenic
1200172254 X:154085751-154085773 GTGGGGGAAAGGGGAGAAGTGGG + Intronic
1200271058 X:154683864-154683886 GTTTGGGGATGGAGAGAAATTGG + Intronic
1201363116 Y:13175009-13175031 ATGAGGGAATGGAGAAGGGTAGG + Intergenic