ID: 1012647942

View in Genome Browser
Species Human (GRCh38)
Location 6:101712238-101712260
Sequence CTGCTCAGTGGACCACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012647942_1012647945 14 Left 1012647942 6:101712238-101712260 CCTGTGTGTGGTCCACTGAGCAG 0: 1
1: 0
2: 1
3: 14
4: 165
Right 1012647945 6:101712275-101712297 ATGCAGAAATACAGAATCTCAGG 0: 1
1: 2
2: 5
3: 49
4: 501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012647942 Original CRISPR CTGCTCAGTGGACCACACAC AGG (reversed) Intronic
902566361 1:17314212-17314234 CTTCTTGGTGGACCAGACACAGG + Intronic
902723769 1:18322171-18322193 GTGCTCAGTGAACCTCTCACTGG + Intronic
905180753 1:36164779-36164801 CTGCTCAGTGGAGCAGAGAGTGG + Intronic
905214378 1:36396613-36396635 CTGGTCAGGGGCCCACACTCTGG + Intronic
905791889 1:40794094-40794116 CAGCTCAGTGCTCCACACAGAGG - Intronic
907707161 1:56842484-56842506 CAGCTCAGTGGACAGCAGACTGG + Intergenic
907951658 1:59189252-59189274 CTGGTCTGTGGACCACACTTTGG - Intergenic
908029791 1:59987123-59987145 CTGCTAAGTGGAGCCCCCACGGG - Intergenic
908814375 1:68016550-68016572 TTGCTCAGTGGACCAGGGACTGG - Intergenic
910427204 1:87129884-87129906 CTGCTCCGTGGACCTCCCAGCGG + Intronic
913074949 1:115334287-115334309 TTGCTAAGTGGATCACACTCTGG - Intronic
915475956 1:156153007-156153029 GTGCTCACTGGACCACACTTTGG - Intronic
916998761 1:170331754-170331776 CAGCCCAGTGGGCCAAACACAGG - Intergenic
917388132 1:174500404-174500426 CTGTTCATTGTACCACATACTGG + Intronic
920653354 1:207855163-207855185 CTGCTAAGTGGAGCAAACGCTGG + Intergenic
922019909 1:221693251-221693273 CTGCTCAGTGGAGCCCCCAGTGG + Intergenic
924615358 1:245607686-245607708 CTGCCCCGTTGACCACAGACTGG - Exonic
1062909525 10:1203813-1203835 CTTCTCAGTGGACCTCAAAGTGG + Intronic
1063980855 10:11450760-11450782 CTGACCAGTGTCCCACACACAGG + Intergenic
1067095133 10:43294882-43294904 GTGCTCAGGGGACCACACAGAGG - Intergenic
1070278750 10:75033561-75033583 CAGCCCAGTGGGCCACACATCGG + Intergenic
1073780365 10:106831627-106831649 ATACACAGTGGACCAAACACTGG + Intronic
1076816285 10:132916548-132916570 ATGCTGAGTGGATCACATACAGG - Exonic
1077401331 11:2359298-2359320 CTTCTAAGCGGAGCACACACAGG - Intergenic
1077444157 11:2582555-2582577 CTGCTCTGGGCACCACACTCAGG - Intronic
1080798792 11:35590082-35590104 CAGCCCAGAGGACCACACACAGG + Intergenic
1084267789 11:68013844-68013866 CTGGGCAGTGGCCCGCACACAGG - Intronic
1085192396 11:74639108-74639130 CTGGTCTGGGGACCACACTCTGG - Intronic
1086500521 11:87448303-87448325 CTGCTCTGTGTTCCAGACACTGG + Intergenic
1090256048 11:125285065-125285087 CTGCCCAGTGGCCCACAGAAAGG - Intronic
1091345086 11:134847028-134847050 CTGCTGAGGGGACGACACAGAGG + Intergenic
1095294051 12:40508295-40508317 TAGCTCAGTGGGCCACAGACAGG - Intronic
1102015624 12:109646084-109646106 CTGCCCAGGGGACAACACCCGGG - Intergenic
1104021678 12:124996230-124996252 CTGCTGAGTGTAGCCCACACTGG + Intronic
1105444724 13:20443215-20443237 CTGCTAACTGGACCACTCCCAGG + Intronic
1106395312 13:29374341-29374363 AAGCTCAGTGAACCACAAACAGG + Intronic
1106535168 13:30634222-30634244 CTGCTAAGTGAACCACAGGCAGG + Intronic
1108604619 13:52025131-52025153 CAACACAGTGGCCCACACACAGG - Intronic
1112278771 13:98044650-98044672 CTGAACAGTGGACCACACTTGGG - Intergenic
1113257773 13:108525686-108525708 TTCCTCAGTGGACCACTCTCTGG + Intergenic
1113642255 13:111965976-111965998 CTGCTCTGTGGCCCACACGGCGG + Intergenic
1114528670 14:23381768-23381790 CTGCTCAGTCAACCACACAAGGG - Intergenic
1116465091 14:45222596-45222618 CTACTCAGTGTCCCACACACAGG - Intronic
1118073329 14:62270495-62270517 TTTCTCTCTGGACCACACACAGG - Intergenic
1118848112 14:69563386-69563408 CTGGTCTGTGGGCCACACTCTGG + Intergenic
1120856409 14:89216541-89216563 CTCCTCATGGGACCACACTCAGG + Intronic
1121816971 14:96936057-96936079 TAGCTCAGAGGACCAGACACTGG + Intergenic
1122429630 14:101632152-101632174 CAGCTTAGTGTTCCACACACTGG - Intergenic
1122599054 14:102912323-102912345 CTGCTCAGTGGGCCACACGTGGG - Intergenic
1122850215 14:104524011-104524033 CTGCTCAGGAGGCCACACCCTGG - Intronic
1123585493 15:21756780-21756802 CTGCTCAGTGCTACACACAGAGG + Intergenic
1123622134 15:22199368-22199390 CTGCTCAGTGCTACACACAGAGG + Intergenic
1124098583 15:26671834-26671856 CTGCTGAGCAGACCACACGCAGG + Intronic
1124795817 15:32777233-32777255 CTGCTAAGTGGATCACAAGCCGG - Intronic
1131399394 15:92112465-92112487 CTGGGCTGTGGCCCACACACAGG - Intronic
1135486349 16:22869005-22869027 CTGTTCAGAGGATCACAAACAGG - Intronic
1138661955 16:58525904-58525926 CTCCCAAATGGACCACACACAGG + Intronic
1142348320 16:89568343-89568365 CTGCTGAGTGAGCCACACAGAGG - Intergenic
1144732685 17:17537554-17537576 CAGCTGAGTGGCACACACACAGG - Intronic
1144961513 17:19046810-19046832 CTGCTGAGTTGGCCCCACACGGG - Intronic
1144973647 17:19127714-19127736 CTGCTGAGTTGGCCCCACACGGG + Intronic
1146937813 17:36823602-36823624 CTGGTCTGTGGACCACACTTTGG - Intergenic
1148017987 17:44536101-44536123 CAGCTCAGTGGAAGACAGACAGG + Intergenic
1150127409 17:62647029-62647051 CTGCTCTAGGGCCCACACACCGG + Intronic
1150692230 17:67376949-67376971 TTGCTTACTGGACCACACATAGG + Intergenic
1151318974 17:73341494-73341516 CAGCTCAGAGGACCCCACCCAGG + Intronic
1151829868 17:76543174-76543196 CTGCTCAGGAGCCCACACCCAGG - Exonic
1157709695 18:49841679-49841701 CTGATCAGTGGTGCACATACAGG + Intronic
1160236879 18:77092876-77092898 CTGCTCAGTGGGGAACACACCGG + Intronic
1160588769 18:79928031-79928053 CTGCTCAGTGGGGCACCCAACGG + Intronic
1162110980 19:8399615-8399637 CTGCTCTGAGGACCAGACACAGG + Intronic
1162258774 19:9515458-9515480 CTGCTCATGGGACAAGACACAGG + Intergenic
1165636815 19:37347254-37347276 CTGCTCAGAGGACCCTGCACAGG + Exonic
1167099423 19:47394960-47394982 CTGCTAAGTGGGCCACGAACTGG - Intergenic
925335729 2:3098010-3098032 CTGCTCTGTAGAGGACACACTGG + Intergenic
926824991 2:16897446-16897468 TTGCTCTGTGAAACACACACTGG + Intergenic
927866369 2:26590456-26590478 CTGCTCTGTGGGCCACACCGGGG + Intronic
928311887 2:30218054-30218076 CTGCTCAGTGGCCAAGACTCCGG - Intergenic
929084844 2:38158148-38158170 CTGCTCAGAGCTCCACACAAAGG + Intergenic
929278514 2:40051961-40051983 CTGCAAAGTGTACCAAACACAGG + Intergenic
935061589 2:99612869-99612891 CTGCTTTGTAGCCCACACACTGG - Intronic
935067101 2:99658724-99658746 CTGCTCTGTGGAGCCCTCACTGG - Intronic
935732060 2:106072662-106072684 CTGCTCAGGGGCCCTCCCACAGG + Intronic
937232401 2:120405816-120405838 CCACCCAGTGGACCTCACACTGG + Intergenic
944673400 2:202015217-202015239 CTCCTCAGAGGAACACCCACAGG - Intergenic
946344733 2:219099985-219100007 CCCCTCAGTGGACCTCCCACTGG - Intronic
948230265 2:236344141-236344163 CTGCTAAGTGCACCACATTCGGG - Intronic
1168837721 20:888764-888786 CTGCTCTGTGGCCCTCACTCTGG + Intronic
1170116971 20:12871007-12871029 ATTCCCAGTGGACCACACACTGG - Intergenic
1172785241 20:37464343-37464365 CTGCTCAATGGAGAAAACACAGG + Intergenic
1173327011 20:42043113-42043135 GTGTTCTGTGGACCACACTCTGG - Intergenic
1175768737 20:61609315-61609337 CTGCCCGGTGGAGCACACACTGG - Intronic
1175815332 20:61880604-61880626 CTGCTCAGTGCCCCACACTTGGG - Intronic
1176219237 20:63962199-63962221 CTGCTCAGAGGGCCACACCCAGG + Intronic
1180208604 21:46279475-46279497 CTGCTCTGTGGGACACACGCAGG - Intronic
1181117904 22:20645184-20645206 CTGAAGACTGGACCACACACTGG + Intergenic
1181489921 22:23255276-23255298 CTGCTCCGTGCAGCACACACAGG + Intronic
1181494390 22:23279837-23279859 CTGCTGAGAGGCTCACACACAGG + Intronic
1183352644 22:37342740-37342762 CTCCTCAGGGGCCCACAGACTGG - Intergenic
1185284716 22:49995105-49995127 CTGCCCAGGGCACCCCACACTGG - Exonic
950262588 3:11553615-11553637 CTGGTCACTGGACCGCAGACCGG + Intronic
951706182 3:25546332-25546354 CTGCTCCGTCGAGCACAGACTGG + Intronic
952119522 3:30225658-30225680 GGGCTCAGGGGACGACACACTGG - Intergenic
956213606 3:66826286-66826308 CTGCTCAGTAGAGCAAAGACTGG - Intergenic
967845133 3:194037005-194037027 ATACTCAGTGTCCCACACACAGG + Intergenic
968628309 4:1637817-1637839 CAGCCCAGTGGATCCCACACGGG + Intronic
969137353 4:5040716-5040738 CTGCCCTGTAGGCCACACACTGG + Intergenic
969359914 4:6657041-6657063 CTGGTCTGTGGCCCACAAACGGG - Intergenic
969451673 4:7277354-7277376 CTGCTGTGTGGGGCACACACAGG - Intronic
969876904 4:10142256-10142278 CTGCACAGTGGCCCACACCTAGG + Intergenic
972778593 4:42266009-42266031 GGGCTCAGTGGGCCCCACACTGG + Intergenic
974953306 4:68607193-68607215 CAGGGCAGAGGACCACACACTGG - Intronic
978422118 4:108543874-108543896 CTTCTCATTGGGCCACAGACTGG - Intergenic
978526416 4:109671493-109671515 CTCATCAGTAGACTACACACTGG - Intronic
986030479 5:3888710-3888732 TTGCACAGTGCACCACACATTGG + Intergenic
988828004 5:34959418-34959440 CTGCTCTGTGGCCCACACTTTGG - Intergenic
990736317 5:58867182-58867204 ATGGTCTGTGGACCACACTCTGG - Intergenic
992801141 5:80297164-80297186 CTTCTCAGTGCATCACACAGGGG + Intergenic
993674714 5:90802892-90802914 CTGCTGAGAGAACCACACACAGG - Intronic
994317636 5:98350770-98350792 CTTCTCAGTGGAAACCACACAGG + Intergenic
995834896 5:116390257-116390279 TTGCTCTTCGGACCACACACTGG + Intronic
996525305 5:124473085-124473107 CTGCTGAGTGGAGCTCCCACAGG - Intergenic
997721207 5:136079550-136079572 CTGCTCAGTGGTCCGCAACCGGG + Intergenic
1000054544 5:157593320-157593342 CTGGTCTGTGGACCACACTTGGG - Intergenic
1001019896 5:168173950-168173972 CTTCTCAGAGGTCCCCACACAGG - Intronic
1003141424 6:3474628-3474650 CTGCTCAGAGGCCATCACACAGG - Intergenic
1004368959 6:15035839-15035861 TTGCTCAAGGGAACACACACAGG - Intergenic
1011629918 6:89313215-89313237 CTACTCCATGGAGCACACACTGG - Intronic
1012647942 6:101712238-101712260 CTGCTCAGTGGACCACACACAGG - Intronic
1016051969 6:139539179-139539201 CTCCTCAGTGAACCAGAAACTGG - Intergenic
1017414773 6:154208057-154208079 CTGCTCTGTGCAACAGACACTGG - Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1019972140 7:4549778-4549800 CTGGGCACTGGGCCACACACAGG - Intergenic
1020385031 7:7591752-7591774 AAGCTCAGTGAACCACAAACAGG - Intronic
1021525535 7:21582898-21582920 CTGGTCAGTGGAGAAGACACCGG + Intronic
1022494204 7:30843132-30843154 CTCTTCTGTGGACCAGACACAGG - Intronic
1023859062 7:44206209-44206231 CAGCCCAATGGGCCACACACAGG - Intronic
1029231771 7:99075684-99075706 CAGCTCAGAGTATCACACACAGG + Intronic
1030082244 7:105788169-105788191 CACCCCAGTGGGCCACACACTGG + Intronic
1030225597 7:107146829-107146851 GTGTTCAGGGGACCACACTCTGG - Intronic
1031877567 7:127159101-127159123 CTGCTCAGTGGACCAGGCTGTGG + Intronic
1032075800 7:128835572-128835594 GTGCTCACTGGCCCACTCACCGG - Exonic
1033369311 7:140694725-140694747 CCGCTCACTGGACCCCAAACTGG + Exonic
1033451349 7:141464871-141464893 CTGCTGCGTGCTCCACACACTGG - Intronic
1034445901 7:151114378-151114400 GTCCTCAGTCCACCACACACTGG - Intronic
1036080864 8:5553963-5553985 CTGCTGAGGGCACCACACCCAGG + Intergenic
1036436824 8:8742628-8742650 CTGCTGAGTGAACCAGAGACTGG + Intergenic
1038081527 8:24142679-24142701 CTGCTCCTTTGACCACACAAAGG - Intergenic
1038252767 8:25921429-25921451 CTGCTCTGTTGACTACACTCGGG - Intronic
1038456547 8:27675366-27675388 CTGCTCAGCACACCACCCACAGG - Intronic
1039328470 8:36510781-36510803 CTGGTCTGTGGACCACACTTTGG - Intergenic
1041101446 8:54399779-54399801 CTGCTCAGTAGACCAGATACTGG + Intergenic
1041711489 8:60898772-60898794 CTGCTCAATGAACTACACCCCGG + Intergenic
1042188304 8:66158939-66158961 CTGCTCAGTAGAGCAAAGACAGG + Intronic
1045437952 8:102183501-102183523 CTGGTCTGAGGACCACACTCAGG + Intergenic
1046404938 8:113761161-113761183 CTGCTCAGGTGACAATACACTGG - Intergenic
1046742688 8:117845799-117845821 CAGCTCAGTGCCCCACCCACAGG - Intronic
1048985075 8:139730818-139730840 CTGTTCCCTGGACCATACACAGG - Exonic
1049217534 8:141415026-141415048 CGACTCAGTGGACCCCACCCAGG - Intronic
1049724882 8:144141160-144141182 CTGCTCAGTTGCTCACCCACAGG + Intergenic
1049750369 8:144280268-144280290 CAGCTCTGTGGTCCACACCCAGG + Intronic
1049767885 8:144363373-144363395 CTACTCAGGGGACCACCCTCTGG - Intergenic
1049858790 8:144883084-144883106 CTGTTCTGTGGACTCCACACAGG - Intronic
1053611498 9:39718461-39718483 TTGCTCAGTGACCCACCCACGGG - Intergenic
1053869530 9:42476516-42476538 TTGCTCAGTGACCCACCCACGGG - Intergenic
1054086757 9:60752699-60752721 TTGCTCAGTGACCCACCCACGGG + Intergenic
1054242022 9:62623924-62623946 TTGCTCAGTGACCCACCCACGGG + Intergenic
1054556146 9:66658442-66658464 TTGCTCAGTGACCCACCCACGGG + Intergenic
1055747688 9:79468190-79468212 CTGCCCATGGGAACACACACAGG + Intergenic
1057613840 9:96570471-96570493 CTGCTGAGTTCACCACAGACAGG + Intronic
1060751838 9:126174626-126174648 CTGCCCAGTGGTCCTCACCCAGG + Intergenic
1061928734 9:133821246-133821268 CTGCTCTGTGGACCAGACACTGG - Intronic
1062273413 9:135719993-135720015 CTGAGAAGTGGACCACAAACAGG + Intronic
1062503048 9:136859392-136859414 CAGCTCCTGGGACCACACACTGG - Intronic
1186553768 X:10535200-10535222 CTGCTCCCTGGACCTCACTCAGG - Intronic
1187259792 X:17674545-17674567 TTGGTGAGTAGACCACACACAGG - Intronic
1190408719 X:50113596-50113618 CTGGTCCTTGGACCACACTCTGG + Intergenic
1192161106 X:68788459-68788481 ATGGTAAGTGGAGCACACACTGG + Intergenic
1193136048 X:77971703-77971725 CTGCTCAATGGTCCAAACACAGG - Exonic
1193530123 X:82645975-82645997 CTTCTCAGTGGACCATAGAGGGG + Intergenic
1199238963 X:145525027-145525049 CTGCTCAGTGTTTCTCACACTGG + Intergenic