ID: 1012651221

View in Genome Browser
Species Human (GRCh38)
Location 6:101755526-101755548
Sequence AACTCTCTAGAGTCTAGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012651221_1012651222 0 Left 1012651221 6:101755526-101755548 CCTAGTCTAGACTCTAGAGAGTT No data
Right 1012651222 6:101755549-101755571 TTCGAGAAGATTTTTCCTCATGG No data
1012651221_1012651223 11 Left 1012651221 6:101755526-101755548 CCTAGTCTAGACTCTAGAGAGTT No data
Right 1012651223 6:101755560-101755582 TTTTCCTCATGGAGATATAATGG 0: 1
1: 0
2: 1
3: 18
4: 285
1012651221_1012651224 12 Left 1012651221 6:101755526-101755548 CCTAGTCTAGACTCTAGAGAGTT No data
Right 1012651224 6:101755561-101755583 TTTCCTCATGGAGATATAATGGG 0: 1
1: 0
2: 3
3: 23
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012651221 Original CRISPR AACTCTCTAGAGTCTAGACT AGG (reversed) Intronic