ID: 1012651221

View in Genome Browser
Species Human (GRCh38)
Location 6:101755526-101755548
Sequence AACTCTCTAGAGTCTAGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012651221_1012651224 12 Left 1012651221 6:101755526-101755548 CCTAGTCTAGACTCTAGAGAGTT 0: 1
1: 0
2: 1
3: 10
4: 93
Right 1012651224 6:101755561-101755583 TTTCCTCATGGAGATATAATGGG 0: 1
1: 0
2: 3
3: 23
4: 255
1012651221_1012651223 11 Left 1012651221 6:101755526-101755548 CCTAGTCTAGACTCTAGAGAGTT 0: 1
1: 0
2: 1
3: 10
4: 93
Right 1012651223 6:101755560-101755582 TTTTCCTCATGGAGATATAATGG 0: 1
1: 0
2: 1
3: 18
4: 285
1012651221_1012651222 0 Left 1012651221 6:101755526-101755548 CCTAGTCTAGACTCTAGAGAGTT 0: 1
1: 0
2: 1
3: 10
4: 93
Right 1012651222 6:101755549-101755571 TTCGAGAAGATTTTTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012651221 Original CRISPR AACTCTCTAGAGTCTAGACT AGG (reversed) Intronic
902041513 1:13495914-13495936 AACTCTCAAAAGTAGAGACTTGG - Intronic
903697954 1:25222875-25222897 AATTTGATAGAGTCTAGACTCGG - Exonic
912332100 1:108829332-108829354 ACTTCTGTAGGGTCTAGACTAGG + Intronic
913105729 1:115612554-115612576 GACTCTTTAGAGTCTAGAGGTGG - Intergenic
913560878 1:120018237-120018259 AACTCATTAGAATGTAGACTGGG - Intronic
913637250 1:120775365-120775387 AACTCATTAGAATGTAGACTGGG + Intergenic
916404583 1:164485338-164485360 AACTCTGTAGAGATTATACTCGG - Intergenic
916926171 1:169523152-169523174 GAATCTCTAGACTCTAGACTTGG - Intronic
918221945 1:182443405-182443427 AATTTTCTAGACTCTACACTTGG - Intergenic
919074862 1:192800650-192800672 AAGTCTGTAGATTCTAGCCTTGG + Intergenic
920102695 1:203527773-203527795 AGCTATCTAAAGTCTAGTCTAGG + Intergenic
920238378 1:204525126-204525148 CACTCTCTAGATGCAAGACTGGG - Intronic
921469468 1:215531384-215531406 AATTCTCTAGGGGCCAGACTGGG + Intergenic
922054440 1:222027134-222027156 AGCTCTCTACAGTCCAGACTTGG + Intergenic
1069682578 10:70295832-70295854 AACTCTCTGGAGTGTGAACTGGG + Intergenic
1071694375 10:87856518-87856540 CACCCTCTGGGGTCTAGACTAGG - Intergenic
1074151653 10:110764649-110764671 AACTCTCTCGAGTCTGGAAAGGG - Intronic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1081074704 11:38656538-38656560 TACTCTCTACACTCTAGAGTAGG + Intergenic
1086576403 11:88343033-88343055 GACTCTCCAGAGTCTAGAGGTGG + Intergenic
1087291583 11:96326499-96326521 AACTATCTCGAGTTTAGGCTGGG + Intronic
1090239287 11:125170840-125170862 AACTCTCCAGAGTCTGCTCTGGG - Intronic
1090897487 11:130991388-130991410 GCCTCTCTAGACTGTAGACTTGG - Intergenic
1090915215 11:131156972-131156994 AACTCTCTAATGTCTAGGCCAGG + Intergenic
1091137853 11:133208401-133208423 AACTCTCTGGAGTTTACTCTGGG + Intronic
1094165095 12:27435395-27435417 ACCTCTTTAGAGTTTAGAGTAGG - Intergenic
1100163525 12:91890359-91890381 AAGTATCTAGACTTTAGACTTGG + Intergenic
1103601756 12:122058928-122058950 AACTCTCTGGAGTCCACGCTTGG + Intronic
1104111391 12:125708077-125708099 AACCCTGCAGAGTTTAGACTGGG - Intergenic
1108459992 13:50656278-50656300 AACTCTATAGAAGCTAGATTTGG + Intronic
1121590935 14:95108491-95108513 AACACTCTGGAATCTAGAGTTGG + Exonic
1125377960 15:39053559-39053581 AAGTCTCTAGAGTATTGACCTGG - Intergenic
1130929828 15:88416095-88416117 GAGTCTCTTGAGTCTAGGCTGGG - Intergenic
1131578624 15:93617828-93617850 ATCTCTCCAGAGCCTAGTCTGGG + Intergenic
1147175503 17:38653798-38653820 TATTGTCTAGAGTCTAGACCAGG + Intergenic
1150996176 17:70320149-70320171 ATCTCTCACCAGTCTAGACTAGG + Intergenic
1166680744 19:44765140-44765162 ACCTGTCTGGAGTCTAGACTGGG - Intergenic
926495335 2:13579920-13579942 AGCTCTTCAGTGTCTAGACTTGG + Intergenic
930279791 2:49356563-49356585 AACTCTATAGAAGTTAGACTAGG + Intergenic
933667485 2:84975340-84975362 AACTATCAAGAGTCTAGAAGGGG + Intronic
935568847 2:104637637-104637659 ATCTCTCTGGAGTCTCGAGTTGG - Intergenic
938312460 2:130302018-130302040 CACTCTCTAGAGTCTGGAATTGG - Intergenic
940747645 2:157587026-157587048 AATTCTCTAGAGTCTAGCTGAGG - Intronic
942237249 2:173922808-173922830 CACTCTCTGGAGTCTATACTAGG - Intronic
942703965 2:178747150-178747172 ATCTCTCTAGAGTCTCTCCTGGG + Intronic
943299395 2:186178923-186178945 AACTTTCTTGAATCTAGACCTGG - Intergenic
945946118 2:215997574-215997596 ACCTCACTAGAGTCTAGCATGGG + Intronic
948549667 2:238761919-238761941 TACTCTCTAGCGGCAAGACTTGG - Intergenic
1169367844 20:5005577-5005599 ATCTCTCTGGAGTCTAGACCTGG + Intronic
1173096821 20:40041273-40041295 AATTTTCTAGAATATAGACTTGG + Intergenic
1179568631 21:42264834-42264856 AGCTCTCCAGGGTCTTGACTGGG + Intronic
1180197562 21:46206839-46206861 AACTCTCTAGAGGCAACACTAGG + Intronic
1183554664 22:38515885-38515907 AACTCTCTCGGGTCTGGATTAGG + Intergenic
956091913 3:65677149-65677171 AAATCTTTAGAGTTCAGACTAGG + Intronic
957122693 3:76116053-76116075 ACCTCTCTAAAATCTAGACCTGG - Intronic
959733849 3:109634955-109634977 AAATCTCTAAACTCTAGTCTAGG - Intergenic
960030625 3:113050988-113051010 AACACTCAAGACTCTAAACTAGG - Intergenic
960356291 3:116657510-116657532 AACTCCCTAGAGTCCATACATGG - Intronic
960426834 3:117518984-117519006 AACGCTCTAGAGCCTGGTCTAGG - Intergenic
961196223 3:125003693-125003715 AGCTCTCCAGAGCCTTGACTGGG - Intronic
965621315 3:170644803-170644825 AAGTCTCTAGAACCAAGACTGGG - Intronic
965642128 3:170840143-170840165 AACCCTCTAGAGTCTGGATCAGG + Intronic
970765834 4:19547926-19547948 AACAGGCTAGAGTCAAGACTTGG + Intergenic
971340677 4:25765927-25765949 AACTGTCTAGAGTCCAGGCACGG - Intronic
975488010 4:74956421-74956443 TATTCTTTGGAGTCTAGACTTGG + Intronic
978347217 4:107784390-107784412 AACCCTCTTGGGTCCAGACTGGG + Intergenic
978984263 4:114989952-114989974 AACTCACTAAAGGCTAGACAGGG - Intronic
979600495 4:122582140-122582162 AATTCTGTAGATTCTAGACTTGG - Intergenic
980859929 4:138486803-138486825 TACTCTCTAAACTCTAGACAAGG + Intergenic
984209107 4:176823839-176823861 AATTCCCTGGAGTATAGACTTGG + Intergenic
987211566 5:15688927-15688949 AACCCTCTAGAATCCATACTGGG + Intronic
989319000 5:40112951-40112973 AACTCTCCAGAGTCCTGCCTTGG - Intergenic
990343699 5:54850502-54850524 GACTCACTTTAGTCTAGACTAGG - Intergenic
990982951 5:61618034-61618056 GACTCCATAGAGTCTAGATTTGG - Intergenic
991951727 5:71953080-71953102 AACTCTCTCGATTGTAGACAAGG + Intergenic
993477477 5:88382946-88382968 ACCTCTCTACAGCCTACACTGGG - Intergenic
993976097 5:94483252-94483274 AATTCCCAAGAGTCTAGCCTAGG + Intronic
995646376 5:114317191-114317213 AAATCTCTATAGTCCAGACAAGG - Intergenic
997733050 5:136194475-136194497 AACACTGTAGAGTCAGGACTTGG - Intergenic
999206108 5:149849181-149849203 AATTCTCAACAGTCTAGGCTTGG - Exonic
999297078 5:150466354-150466376 GACTCTCAGGAGTTTAGACTTGG + Intergenic
1001782279 5:174380205-174380227 AACTAACTAGAGTATTGACTAGG + Intergenic
1002930205 6:1629079-1629101 AACTATCTGGAATCTTGACTAGG - Intronic
1008279083 6:49573961-49573983 AACTGTTTAGAGTCTGGGCTGGG + Intergenic
1012651221 6:101755526-101755548 AACTCTCTAGAGTCTAGACTAGG - Intronic
1014593651 6:123305396-123305418 ATCTATCTATAGGCTAGACTAGG + Intronic
1015227304 6:130872526-130872548 ACCTCTCTAGAGCCTAGAAGAGG - Intronic
1016200596 6:141402894-141402916 AACTCTCAAATGTCAAGACTCGG - Intergenic
1021961402 7:25876694-25876716 GGTTCTCTGGAGTCTAGACTCGG + Intergenic
1023456652 7:40346782-40346804 AACTCTCTAGTGTCTCTTCTTGG - Intronic
1024297595 7:47857881-47857903 AACTGTCTTGAATCCAGACTAGG + Intronic
1027729024 7:81846074-81846096 AACTCCCCAGAGTCTAAACTAGG + Intergenic
1038168426 8:25106870-25106892 AAGTCTCTATATTCGAGACTGGG - Intergenic
1039346536 8:36711408-36711430 AAGTCTCAACAGTCTTGACTAGG - Intergenic
1044500865 8:92954429-92954451 AGCTCTCCAGAGTTTAGACTTGG - Exonic
1045188860 8:99863951-99863973 AACTCTGCAGAGTCAAGACATGG - Intronic
1051477564 9:17524822-17524844 AACTCTCTAGAGCCTAAACTTGG - Intergenic
1051904647 9:22081338-22081360 AACTCTCTAGAATCGATTCTTGG + Intergenic
1055491846 9:76813399-76813421 GACTTTCTCGAGTCTAGACAAGG - Intronic
1056254738 9:84787396-84787418 AACTCAGTAGACTCTAGACCCGG + Intronic
1059012613 9:110478370-110478392 AAATCCCTAGTGTCTAGAATAGG + Intronic
1195095131 X:101494164-101494186 ACCACTGTAGAGTCTAGGCTTGG + Exonic
1196124754 X:112085281-112085303 AACTACCTAGCTTCTAGACTAGG + Intergenic
1202297021 Y:23369788-23369810 AACTCTCTAGAGTAGACAGTAGG + Intergenic
1202573786 Y:26300809-26300831 AACTCTCTAGAGTAGACAGTAGG - Intergenic