ID: 1012651221 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:101755526-101755548 |
| Sequence | AACTCTCTAGAGTCTAGACT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1012651221_1012651223 | 11 | Left | 1012651221 | 6:101755526-101755548 | CCTAGTCTAGACTCTAGAGAGTT | No data | ||
| Right | 1012651223 | 6:101755560-101755582 | TTTTCCTCATGGAGATATAATGG | 0: 1 1: 0 2: 1 3: 18 4: 285 |
||||
| 1012651221_1012651222 | 0 | Left | 1012651221 | 6:101755526-101755548 | CCTAGTCTAGACTCTAGAGAGTT | No data | ||
| Right | 1012651222 | 6:101755549-101755571 | TTCGAGAAGATTTTTCCTCATGG | No data | ||||
| 1012651221_1012651224 | 12 | Left | 1012651221 | 6:101755526-101755548 | CCTAGTCTAGACTCTAGAGAGTT | No data | ||
| Right | 1012651224 | 6:101755561-101755583 | TTTCCTCATGGAGATATAATGGG | 0: 1 1: 0 2: 3 3: 23 4: 255 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1012651221 | Original CRISPR | AACTCTCTAGAGTCTAGACT AGG (reversed) | Intronic | ||