ID: 1012651223 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:101755560-101755582 |
Sequence | TTTTCCTCATGGAGATATAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 305 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 18, 4: 285} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1012651221_1012651223 | 11 | Left | 1012651221 | 6:101755526-101755548 | CCTAGTCTAGACTCTAGAGAGTT | No data | ||
Right | 1012651223 | 6:101755560-101755582 | TTTTCCTCATGGAGATATAATGG | 0: 1 1: 0 2: 1 3: 18 4: 285 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1012651223 | Original CRISPR | TTTTCCTCATGGAGATATAA TGG | Intronic | ||