ID: 1012651223

View in Genome Browser
Species Human (GRCh38)
Location 6:101755560-101755582
Sequence TTTTCCTCATGGAGATATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 285}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012651221_1012651223 11 Left 1012651221 6:101755526-101755548 CCTAGTCTAGACTCTAGAGAGTT No data
Right 1012651223 6:101755560-101755582 TTTTCCTCATGGAGATATAATGG 0: 1
1: 0
2: 1
3: 18
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012651223 Original CRISPR TTTTCCTCATGGAGATATAA TGG Intronic