ID: 1012651224 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:101755561-101755583 |
| Sequence | TTTCCTCATGGAGATATAAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 282 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 23, 4: 255} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1012651221_1012651224 | 12 | Left | 1012651221 | 6:101755526-101755548 | CCTAGTCTAGACTCTAGAGAGTT | No data | ||
| Right | 1012651224 | 6:101755561-101755583 | TTTCCTCATGGAGATATAATGGG | 0: 1 1: 0 2: 3 3: 23 4: 255 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1012651224 | Original CRISPR | TTTCCTCATGGAGATATAAT GGG | Intronic | ||