ID: 1012651224

View in Genome Browser
Species Human (GRCh38)
Location 6:101755561-101755583
Sequence TTTCCTCATGGAGATATAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 255}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012651221_1012651224 12 Left 1012651221 6:101755526-101755548 CCTAGTCTAGACTCTAGAGAGTT No data
Right 1012651224 6:101755561-101755583 TTTCCTCATGGAGATATAATGGG 0: 1
1: 0
2: 3
3: 23
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012651224 Original CRISPR TTTCCTCATGGAGATATAAT GGG Intronic