ID: 1012659965

View in Genome Browser
Species Human (GRCh38)
Location 6:101875438-101875460
Sequence TTGGCTGAGCAGATATATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012659965_1012659967 18 Left 1012659965 6:101875438-101875460 CCATCATATATCTGCTCAGCCAA 0: 1
1: 0
2: 1
3: 18
4: 138
Right 1012659967 6:101875479-101875501 ATGTTACAGTGCAATTGAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012659965 Original CRISPR TTGGCTGAGCAGATATATGA TGG (reversed) Intronic
904195453 1:28782049-28782071 TGGGCCTTGCAGATATATGAGGG - Intergenic
906721132 1:48005584-48005606 TTTGCTGAGAAGCTATAGGAGGG + Intergenic
907508548 1:54941049-54941071 TGGGCTGAGCAGATACAAGCTGG - Intergenic
908324121 1:63006679-63006701 TTAGCTGAGCAGATATAAAAGGG - Intergenic
908858015 1:68451046-68451068 TTGGATGGGCAGAGATATTATGG - Intergenic
911206372 1:95095327-95095349 GTGGCAGAGCTGACATATGAAGG - Intergenic
912067391 1:105761066-105761088 TTGGCTCAGGATAAATATGACGG + Intergenic
912555561 1:110513717-110513739 GAGGCTGGGCAGATGTATGATGG + Intergenic
912816341 1:112831686-112831708 TTGGTTGAGCATATAAATGGAGG - Intergenic
913076519 1:115344830-115344852 TTGCCTGAGCAGGTAAATGATGG + Intergenic
915203468 1:154251506-154251528 CTGGCTCAGCAGATATCTCAGGG + Exonic
917708193 1:177656305-177656327 TGTTCTGAGTAGATATATGAGGG + Intergenic
919488241 1:198171087-198171109 TTGGTTTATGAGATATATGAAGG + Intronic
922588461 1:226753792-226753814 ATGTCTGAGCAGAGATCTGAAGG + Intergenic
922887758 1:229032902-229032924 TTGCCTGAGCAGAGAAATGGAGG + Intergenic
923787545 1:237082660-237082682 TTGGCTAAGCAGATGTGTGTGGG + Intronic
1063063638 10:2586189-2586211 TTGGCTAAGCATCTATATGTAGG - Intergenic
1063110906 10:3036582-3036604 TTGGCTGACCAGATGTATAATGG + Intergenic
1066242995 10:33555887-33555909 GAGGCTGAGCAGATAGATGTTGG + Intergenic
1066985061 10:42457805-42457827 TTGGCTGAGAAGAGAGATGTAGG + Intergenic
1067275132 10:44827461-44827483 TTGACTGAGCAAATATTTGACGG + Intergenic
1069422700 10:68261117-68261139 ATGGCTGAGCAGAACTAGGAGGG + Intergenic
1070662874 10:78320098-78320120 TTGGCTGAGCACATGGAAGAGGG + Intergenic
1071364779 10:84888097-84888119 TTGTTTGACCACATATATGAGGG + Intergenic
1071477144 10:86034790-86034812 CTGGATGAACAGATGTATGATGG + Intronic
1072304811 10:94096832-94096854 TTTGCTGAGCAGAGGGATGAAGG + Intronic
1075948847 10:126460331-126460353 TTTGCTGAGCATATACATGCAGG - Intronic
1079383831 11:19961334-19961356 GTGGCTCAACAGATTTATGATGG + Intronic
1081825450 11:46046616-46046638 TTGACAGAGAAGATATATGAGGG - Intronic
1082222489 11:49656781-49656803 TTGGATGAGTAGATATATGAAGG + Intergenic
1084573107 11:69971415-69971437 TTTGCTGAGCAGCTGAATGATGG + Intergenic
1085925342 11:81012426-81012448 CTGGCATAGCAGATACATGAAGG + Intergenic
1086853138 11:91835169-91835191 TTGGATGACCAAATATATCATGG + Intergenic
1095893797 12:47260185-47260207 TTGGCTAAGCAAATAAATAAAGG - Intergenic
1096812362 12:54179413-54179435 TTAGCTGAGGAAATATATAATGG - Intronic
1096972312 12:55677552-55677574 ATGACAGAGCACATATATGATGG - Intergenic
1097029267 12:56079942-56079964 TTGGCGGAGCAGATCGAGGATGG - Exonic
1098937061 12:76492229-76492251 TTAGCTATGCAGATATCTGAGGG + Intronic
1100948717 12:99820688-99820710 TTGGCTTAAAAGATATTTGAGGG - Intronic
1102199794 12:111049372-111049394 TTGGCTGAGTAGATGTTGGATGG - Intronic
1107403182 13:40089145-40089167 TGGTCTGAGCTGAAATATGAAGG + Intergenic
1107579200 13:41764133-41764155 TTGGCTGTGCTGTTATATGGGGG - Intronic
1108821866 13:54361611-54361633 TTTGCTGAGCAATTATATCATGG - Intergenic
1109793929 13:67285465-67285487 ATGGCTGAGAAGAAATAAGAAGG + Intergenic
1111854394 13:93619082-93619104 TTGACAGATCATATATATGATGG - Intronic
1115518571 14:34209866-34209888 TTTGCAGAGCAGATACATTACGG - Intronic
1116254784 14:42538251-42538273 TTGGATAAGCAGATATATGCTGG + Intergenic
1118752642 14:68817826-68817848 TTGCCTGAGCAGATTTATGTAGG + Intergenic
1119585729 14:75833073-75833095 TTGGCTGAGGAGAATGATGAAGG - Intronic
1119590378 14:75881419-75881441 TAGGCTAAGCAGATATGAGAGGG - Intronic
1121066797 14:90974797-90974819 TTGGCTGAGCAGTTCTCTAATGG - Intronic
1121438633 14:93934980-93935002 TGGGCTGTGCAGATCAATGAGGG - Intronic
1121545232 14:94758373-94758395 TTGGCTGGGCAGATACTGGAAGG - Intergenic
1129927166 15:79374942-79374964 GTTGCTGAGCAGATACATGAAGG + Intronic
1134203265 16:12216358-12216380 TGGGCTCAGAAGAAATATGATGG + Intronic
1135844510 16:25906715-25906737 TTTGCTGAGCAAATTCATGAAGG + Intronic
1137029631 16:35509517-35509539 TTGACAGACCATATATATGAGGG - Intergenic
1137036141 16:35571590-35571612 TGGGCTGAGCACATATGTGAGGG + Intergenic
1137055308 16:35743198-35743220 TGAGCTGAGCAGATATAAGAAGG + Intergenic
1140051529 16:71485615-71485637 TTGGATGACCTGATAGATGAAGG + Intronic
1140663554 16:77209973-77209995 TTGGCTAAGTGAATATATGATGG - Intronic
1150396064 17:64822935-64822957 TTGGATGAGCAGATGTGTCAGGG - Intergenic
1150911865 17:69396241-69396263 TCGGCTGAACAGTTAGATGATGG - Intergenic
1153995518 18:10438318-10438340 TTGGAAGAGTAGAGATATGAAGG + Intergenic
1158279757 18:55811269-55811291 TAGGCTTAGCAGGTGTATGAGGG - Intergenic
1158308097 18:56128373-56128395 TTGGCGGAGCAAAGTTATGAAGG - Intergenic
1160427895 18:78790794-78790816 TTGGGTGAGCAGAAAGATAATGG - Intergenic
930055722 2:47250656-47250678 CAGGCTGAGCAGGTATAGGATGG + Intergenic
931003515 2:57819599-57819621 TTGACTGAGAAGATAGAGGAAGG + Intergenic
931571516 2:63673712-63673734 TAGACTGTACAGATATATGATGG - Intronic
932920425 2:75907876-75907898 TTGGCTTTGAAGATATAGGAAGG - Intergenic
937281163 2:120718141-120718163 TTGGCTTTGCAGATGTAGGAAGG - Intergenic
938592142 2:132749754-132749776 GTGGCTAAGCAGACATTTGAAGG - Intronic
942951245 2:181724357-181724379 TTGTCTGAGCTGAAATATGGAGG + Intergenic
945312423 2:208330107-208330129 TTAGATGGGCAGAGATATGAGGG - Intronic
946609550 2:221442551-221442573 TTGGCCTAGCAAATATCTGAAGG + Intronic
947425860 2:229982327-229982349 TTGGCTTTGCAGATAGAGGAAGG - Intronic
1170314546 20:15028692-15028714 ATGGCTGAGCTGAGATGTGAAGG + Intronic
1170909269 20:20548010-20548032 GTGGCAGACCACATATATGATGG - Intronic
1171596472 20:26683831-26683853 TTTGCTGAGTAGATACATCATGG - Intergenic
1171633997 20:27246767-27246789 TTTGCTGAGTAGATACATCATGG - Intergenic
1171670536 20:27794496-27794518 TTTGCTGAGTAGATACATCATGG - Intergenic
1171672746 20:27827460-27827482 TTTGCTGAGTAGATACATCATGG - Intergenic
1171689752 20:28082458-28082480 TTTGCTGAGTAGATACATCATGG - Intergenic
1171691294 20:28105580-28105602 TTTGCTGAGTAGATACATCATGG - Intergenic
1171694201 20:28148748-28148770 TTTGCTGAGTAGATACATCATGG - Intergenic
1172512246 20:35508840-35508862 GTGCCTGTGCAGGTATATGAGGG - Intronic
1173002233 20:39112496-39112518 GTGGCTGAGCAGCTGTAGGAAGG + Intergenic
1173871512 20:46344952-46344974 ATGGATGGGTAGATATATGATGG - Intergenic
1174184999 20:48700069-48700091 TTGGCTGAGTAGGTAGATGGAGG - Intronic
1175030031 20:55943317-55943339 ATGACTGACCACATATATGATGG - Intergenic
1175316469 20:58051726-58051748 TTGGGTGAGCATATATTTTAAGG - Intergenic
1177001215 21:15615461-15615483 TTTACTCAGCAGATATTTGAGGG - Intergenic
1177778006 21:25590968-25590990 TTAGCTGAGCATATTTATGTAGG - Intronic
1178094902 21:29204122-29204144 ATGGATGAGCAGATTTTTGATGG + Intronic
1183280227 22:36928274-36928296 TTGGCTGAGCAGGTTTCTGATGG + Intronic
1184248804 22:43248896-43248918 TTGGCTCAGCACATGAATGAAGG - Intronic
1184425949 22:44409433-44409455 TTGGCTGAGCACAGGTGTGAGGG - Intergenic
1185321703 22:50203564-50203586 TTTGCTGACCATATATGTGAAGG - Intronic
949455610 3:4235264-4235286 TTGCCTGAGCAATTATCTGAGGG + Intronic
955874138 3:63472569-63472591 TTGAGTAAGCAAATATATGAAGG - Intronic
959735861 3:109657104-109657126 TTGGCTGAGGAGGTATATGCTGG - Intergenic
961920764 3:130423541-130423563 TTGGAAGAGCAAATATATGAGGG - Intronic
964592503 3:158380036-158380058 TTTTCTGGTCAGATATATGAAGG + Intronic
964702539 3:159584962-159584984 TTGGCTGCACACATATCTGAGGG - Intronic
965133412 3:164730813-164730835 TTGGCTGCTCAGAAATATAAAGG - Intergenic
966035057 3:175401714-175401736 ATGGCAGACCACATATATGATGG - Intronic
968423636 4:506213-506235 CTGTCTGAGCCGAGATATGATGG + Intronic
972997038 4:44893226-44893248 TTGGCTGAACATAGATTTGATGG - Intergenic
974078579 4:57190409-57190431 TTGGAAGATCAGATATTTGATGG + Intergenic
975447842 4:74487339-74487361 TTGGATGAACAAATAAATGAAGG - Intergenic
978049179 4:104174690-104174712 TTTACAGAGAAGATATATGAGGG - Intergenic
981790105 4:148526758-148526780 TTTGCTGAGCTGATATATACTGG - Intergenic
983992938 4:174144202-174144224 TTGACAGGCCAGATATATGATGG + Intergenic
985821235 5:2161389-2161411 ATGGATGGGCAGGTATATGATGG - Intergenic
989595798 5:43155081-43155103 TTGGCTAAGCTGAAATTTGACGG - Intronic
990972515 5:61524676-61524698 TTGGCTGAGCACAGACATAAGGG - Intronic
991131696 5:63130199-63130221 CTGGGTAAGCAGATATAGGATGG - Intergenic
992538515 5:77738058-77738080 TTGGATGAGCAGAGGCATGAAGG + Intronic
994046677 5:95318046-95318068 TTCTCAGAGCAAATATATGATGG - Intergenic
1001944560 5:175767948-175767970 TAGGCTGAGGAGATATCAGAAGG - Intergenic
1010478845 6:76324274-76324296 TTAGATGAGCAGATAAAAGAGGG - Intergenic
1010582837 6:77620498-77620520 TTGACTGAGAAGGGATATGAGGG - Intergenic
1010819986 6:80402902-80402924 TTAGTTGATCAGATATGTGAAGG + Intergenic
1011520426 6:88198286-88198308 TTGGCTGAGCAGGGCTATGAAGG + Intergenic
1011547541 6:88498088-88498110 TGGAGTGAGCAGATATAGGATGG - Intergenic
1012659965 6:101875438-101875460 TTGGCTGAGCAGATATATGATGG - Intronic
1012965097 6:105665772-105665794 TTGGATGAACATGTATATGAGGG + Intergenic
1012980204 6:105821393-105821415 TTGCCTGAGAAGTGATATGAGGG + Intergenic
1015816300 6:137214595-137214617 GTGGCTGAGCAGATATTTATTGG - Intronic
1021072908 7:16265003-16265025 TTGGCTAAGCTAATATGTGAAGG + Intronic
1021153943 7:17186417-17186439 AGGGCTGAGCAGACATGTGAGGG - Intergenic
1021556319 7:21922376-21922398 TAGGCTGAACACATATATCAGGG + Intronic
1021865569 7:24953272-24953294 TTGGCAGAGCTGACAAATGATGG - Intronic
1022906331 7:34861334-34861356 TTGGACAAGCAGATATCTGAGGG - Intronic
1023887503 7:44370144-44370166 TTGGTAGAGCAGATATACAAAGG + Intergenic
1025784927 7:64635529-64635551 TTGGCTGGGCATGCATATGAAGG - Intergenic
1027705565 7:81529004-81529026 CTGGTTGAGCAGATATTTTATGG - Intergenic
1032332733 7:130994980-130995002 TTGGCTGAGCAGGTATGTGTGGG + Intergenic
1033642688 7:143277290-143277312 TTGACTGGGAAGATATATGAGGG + Intergenic
1034760674 7:153669083-153669105 TGGGCTGAGGTGATATCTGAGGG + Intergenic
1037385760 8:18338765-18338787 CTGGCTGAGCCGATTAATGAGGG + Intergenic
1046816239 8:118586825-118586847 TAGACTGAGCATAGATATGATGG + Intronic
1047524465 8:125620667-125620689 TAGGCTGAGAAGATATCTGCAGG - Intergenic
1048003829 8:130402101-130402123 GTGGCTGTCCAGAAATATGAAGG + Intronic
1048434491 8:134403314-134403336 TTGACTGGGCAGTTATGTGATGG - Intergenic
1055209620 9:73774693-73774715 TTTGCTGAGCAGATATTGAATGG - Intergenic
1058566800 9:106294380-106294402 TTTGCTGAGCAGAGATCTGATGG - Intergenic
1060577785 9:124713104-124713126 TTGTTTGACCATATATATGAGGG - Intronic
1062403857 9:136384285-136384307 TGGGGGGAGCAGATATGTGAGGG - Intronic
1186990323 X:15060142-15060164 CAGGCTGAGCAGATAGATGAGGG + Intergenic
1188362009 X:29266513-29266535 TAGGGTTAACAGATATATGATGG + Intronic
1188551738 X:31372255-31372277 TTGGCTGACCAGATGGAGGAAGG + Intronic
1188671832 X:32889955-32889977 TTGGCTGAGATGAAATATGCAGG + Intronic
1192338026 X:70238236-70238258 ATGGCTCAGCAGATAGTTGATGG - Exonic
1198068244 X:133121511-133121533 TGGGCTGAGGATATATATTATGG - Intergenic
1199508678 X:148595179-148595201 TTGGCTAAGTAGAAATATTAAGG - Intronic
1202037690 Y:20650942-20650964 CTGGCTGAGCATGTAGATGAGGG - Intergenic