ID: 1012661850

View in Genome Browser
Species Human (GRCh38)
Location 6:101908094-101908116
Sequence CAGCTCGGACAGAATGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012661850 Original CRISPR CAGCTCGGACAGAATGATGT AGG (reversed) Intronic
903364897 1:22800078-22800100 CAGCTCTGACAGCAGGGTGTGGG - Intronic
903651965 1:24928025-24928047 CAGCTCAGTCACTATGATGTGGG + Intronic
903847732 1:26288469-26288491 CAGCACTGAGAGAATGAGGTGGG + Intronic
905769244 1:40626652-40626674 CAGCTCGTCCAGCATGATCTGGG + Exonic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
919055413 1:192564288-192564310 CTGCTCAGACAGAGGGATGTAGG + Intergenic
1067942888 10:50670781-50670803 CAGCACAGTCAGAAAGATGTGGG - Intergenic
1070864130 10:79695745-79695767 CAGCACAGTCAGAAAGATGTGGG - Intergenic
1071446165 10:85749617-85749639 CAGATCGTATAGAATGTTGTAGG - Intronic
1073218637 10:101851493-101851515 CAGCTCTGACAGAAGGGGGTTGG + Intronic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1079341555 11:19615972-19615994 CAGCTCTGAGAGCATGATGATGG - Intronic
1084174164 11:67415167-67415189 CAGCTGGGACAGAAAGCTGCAGG + Intronic
1084691365 11:70728881-70728903 CAGCACGGACTGACTGGTGTTGG + Intronic
1086648739 11:89259722-89259744 CAGCTTGGAAGGAAAGATGTGGG - Intronic
1097288390 12:57894849-57894871 CAGGTGGGACAGAGTGAAGTGGG + Intergenic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1100217116 12:92463109-92463131 CCACTAGGACATAATGATGTGGG - Intergenic
1100689919 12:97028837-97028859 CAGATCAGAGAGAATGGTGTAGG + Intergenic
1102555016 12:113721023-113721045 CAGCAAGGACAGAATGATGAAGG + Intergenic
1106356429 13:28987636-28987658 CAGCTGGGACAGGATGGTGGTGG - Intronic
1113897728 13:113776494-113776516 CAGCTCGGACAGCAGCAGGTGGG - Intronic
1114751836 14:25213061-25213083 CAGTTCATACAGAATAATGTGGG - Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1121903992 14:97723271-97723293 CAGGTCGGACAAAATGGTCTGGG + Intergenic
1128112193 15:65083651-65083673 CAGCTGGGGCAGAATCATGAGGG - Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1136389164 16:29951464-29951486 CAGCTCGGACACAGTGGGGTAGG - Intronic
1137874249 16:51980641-51980663 CACCTCGGACAGAGTGACGCAGG - Intergenic
1137891898 16:52171733-52171755 CAGTTAGGATTGAATGATGTGGG - Intergenic
1139051968 16:63135069-63135091 CAGGCAGCACAGAATGATGTCGG + Intergenic
1140937489 16:79687661-79687683 CAGGTTGGACAGAATGAAGGTGG + Intergenic
1142975703 17:3642750-3642772 CAGCAAGGGCAGAATGAGGTTGG - Intronic
1153873053 18:9338472-9338494 CAGCTGGGAGTGAATAATGTAGG - Intronic
1156576351 18:38320726-38320748 CAGCTAGGACAGTGTAATGTTGG + Intergenic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
926037697 2:9648192-9648214 CAGCTCGCAAAGAATGCTGATGG - Intergenic
927679867 2:25132174-25132196 GACCTCGGAGAGAATGAAGTCGG + Intronic
931277689 2:60757942-60757964 CAGCTCTGACACCATGATGACGG - Intronic
933981818 2:87556546-87556568 GAGCTGGGACAGGATGATGAGGG + Intergenic
936312020 2:111394271-111394293 GAGCTGGGACAGGATGATGAGGG - Intergenic
936341004 2:111632761-111632783 CACCTTGCACTGAATGATGTGGG + Intergenic
938430828 2:131236196-131236218 CAGCTCGGAGTGAATGCTGAGGG + Intronic
939805789 2:146774885-146774907 CAGCACGGAAAGAAAGATGAAGG - Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
944420739 2:199527271-199527293 CAGCTCAGACAGGTCGATGTTGG - Intergenic
945622091 2:212152650-212152672 AAGCTCAGAAAGAATGATGTGGG - Intronic
945791389 2:214309871-214309893 CAGCTGGGACAGCAGGTTGTGGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
947247851 2:228069934-228069956 CAGCTGGGACACAGTGAGGTGGG - Intronic
1179948068 21:44693153-44693175 CAGATGGGAAAGAATGAAGTTGG + Intronic
1181781650 22:25198081-25198103 CAGCTGGGACAGAAGGAGGAAGG - Intergenic
1181864489 22:25844712-25844734 CAGCTCTGACATAATGTTCTGGG - Intronic
1183471446 22:38009143-38009165 CAGCTGGGACAGAATGAGCGAGG + Intronic
1184172955 22:42770053-42770075 CAGCACGGACAGACGGATGGCGG - Intergenic
1184970830 22:48018801-48018823 CAGCTGGGAGAGGATGATGGTGG + Intergenic
949735853 3:7170818-7170840 CAGGTCATACAGAATCATGTAGG - Intronic
952460230 3:33517145-33517167 CAACTAGGTCAGAATGATCTAGG + Exonic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
952845930 3:37688145-37688167 CAACTCAGGCAGAAAGATGTGGG + Intronic
955793522 3:62611660-62611682 CAGCTATAACAGATTGATGTAGG - Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
958962247 3:100521660-100521682 CAACTGGCACAGAATGATGTGGG - Intronic
960574731 3:119218470-119218492 CTACTGGCACAGAATGATGTGGG + Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
963632870 3:147755407-147755429 CAGCTAGGAAATAATGATTTAGG + Intergenic
966071222 3:175880883-175880905 CAGCTAGTACAGAATTTTGTGGG - Intergenic
968135190 3:196215611-196215633 CAGGTCAGACAGAAAGCTGTGGG - Intronic
969858275 4:10017230-10017252 CACCTGGGATAGAATGATATGGG - Intronic
970606166 4:17683879-17683901 CAGCCTGGACAGCATGATGAAGG + Intronic
972680446 4:41301487-41301509 TAGCTCATACAGTATGATGTTGG + Intergenic
974757983 4:66237382-66237404 CAGCTCCCACAGAAACATGTGGG + Intergenic
981282211 4:142971347-142971369 CAGTTCTCACAGGATGATGTAGG + Intergenic
981792107 4:148549860-148549882 CAGCACGTACAGAATGAAGAAGG - Intergenic
985096484 4:186417321-186417343 GAGCACGGGCAGCATGATGTCGG - Intergenic
985096504 4:186417435-186417457 GAGCACGGGCAGCATGATGTCGG - Intergenic
985096511 4:186417473-186417495 GAGCACGGGCAGCATGATGTCGG - Intergenic
985096517 4:186417511-186417533 GAGCACGGGCAGCATGATGTCGG - Intergenic
985096523 4:186417549-186417571 GAGCACGGGCAGCATGATGTCGG - Intergenic
985096530 4:186417587-186417609 GAGCACGGGCAGCATGATGTCGG - Intergenic
985096537 4:186417625-186417647 GAGCACGGGCAGCATGATGTCGG - Intergenic
985096543 4:186417663-186417685 GAGCACGGGCAGCATGATGTCGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995215935 5:109594424-109594446 CAGCTTTGACAGAAAAATGTGGG - Intergenic
1000581316 5:163038344-163038366 CAGTTCGTAGAGAGTGATGTAGG + Intergenic
1003113190 6:3265700-3265722 CAGCTAGGAAAGGATGAGGTTGG + Intronic
1006073729 6:31516028-31516050 CAGCCAGGTCAGAGTGATGTTGG - Intergenic
1008559003 6:52704934-52704956 CACCTCTGACAGCATGATCTTGG - Intergenic
1010109803 6:72213245-72213267 CAACTGGGACAAAATGAAGTGGG - Intronic
1010354454 6:74915119-74915141 CAGATGGGAAAGAATGATGTGGG - Intergenic
1012661850 6:101908094-101908116 CAGCTCGGACAGAATGATGTAGG - Intronic
1016799330 6:148153010-148153032 CATCATGGAGAGAATGATGTTGG + Intergenic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019315062 7:380518-380540 CAGCTCGGACAGAGGGAGGGAGG + Intergenic
1023329620 7:39100857-39100879 CAGCGTGGAAAGAATGATGTTGG + Intronic
1027409977 7:77905855-77905877 CAACTAAGACAGAATGTTGTTGG - Intronic
1035522282 8:284473-284495 CAGCCCAGACAGAAGGATGAGGG - Intergenic
1035762640 8:2080889-2080911 CAGCCCGTGCAGAATGAGGTTGG + Intronic
1037292046 8:17361335-17361357 CAGGTGGGACAGAATGTTTTCGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1043458708 8:80438118-80438140 CAGCTAGCACAGAAAGAGGTGGG + Intergenic
1043851538 8:85221596-85221618 CAGCTCAGGCAGAGTGAAGTAGG - Intronic
1044163725 8:88953857-88953879 CAGCCAGGACAGAGAGATGTTGG + Intergenic
1048816633 8:138340432-138340454 CAGCATGGACATAAGGATGTGGG - Intronic
1052795948 9:32923635-32923657 CAAATCAAACAGAATGATGTTGG + Intergenic
1056606819 9:88092855-88092877 CAGCTCGAACAGAAAGCTGATGG - Intergenic
1056888824 9:90470244-90470266 CTGCTGGGACAGACTGAAGTGGG + Intergenic
1057800470 9:98188072-98188094 GAGCTGGGACAGAGTGATGGCGG - Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1186465014 X:9778365-9778387 CAGCTCTGTCAGAAAGACGTGGG - Intronic
1194141677 X:90217175-90217197 CTGTTAGGGCAGAATGATGTAGG + Intergenic
1200698585 Y:6382993-6383015 CAGCTCAGACTGACTGATGGCGG - Intergenic
1201035529 Y:9781706-9781728 CAGCTCAGACTGACTGATGGCGG + Intergenic