ID: 1012665637

View in Genome Browser
Species Human (GRCh38)
Location 6:101964890-101964912
Sequence GAGAACATGTGGCAATTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012665634_1012665637 22 Left 1012665634 6:101964845-101964867 CCAGGTCATGCAAGGCAGAAATG 0: 2
1: 0
2: 1
3: 39
4: 228
Right 1012665637 6:101964890-101964912 GAGAACATGTGGCAATTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012665637 Original CRISPR GAGAACATGTGGCAATTAGC AGG Intronic
No off target data available for this crispr