ID: 1012666658

View in Genome Browser
Species Human (GRCh38)
Location 6:101979429-101979451
Sequence ACTTATCTGTTAAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012666652_1012666658 15 Left 1012666652 6:101979391-101979413 CCGCTGCAAAGGATGGTGGAGGA 0: 1
1: 0
2: 2
3: 17
4: 229
Right 1012666658 6:101979429-101979451 ACTTATCTGTTAAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012666658 Original CRISPR ACTTATCTGTTAAAGGTGGA AGG Intronic
No off target data available for this crispr