ID: 1012669490

View in Genome Browser
Species Human (GRCh38)
Location 6:102024207-102024229
Sequence GTGACTTGTCAGTTTCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012669488_1012669490 12 Left 1012669488 6:102024172-102024194 CCTGTGTGAAGGGCACTCTGTGT 0: 1
1: 0
2: 1
3: 10
4: 182
Right 1012669490 6:102024207-102024229 GTGACTTGTCAGTTTCAAGCTGG 0: 1
1: 0
2: 2
3: 15
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012669490 Original CRISPR GTGACTTGTCAGTTTCAAGC TGG Intronic
902693884 1:18127385-18127407 ATGACCTGTCAGTTTCAATATGG + Intronic
906457396 1:46008910-46008932 CTGAATTTTCATTTTCAAGCAGG + Intronic
912451935 1:109772786-109772808 ATGACTTCTCAGGTTCAAGCTGG - Intronic
923101311 1:230819990-230820012 CTGACTTTTCAGTAACAAGCAGG - Intergenic
1063741509 10:8826856-8826878 GTGAATTGTGAGTTTCCAGTTGG - Intergenic
1063856053 10:10255358-10255380 TTGACTTGCCAGTCTCAAGAAGG - Intergenic
1063905427 10:10775957-10775979 CTGCCTTGTCACTTACAAGCTGG + Intergenic
1070415095 10:76181866-76181888 AGGACTTCTCAGTCTCAAGCAGG - Intronic
1070473869 10:76813066-76813088 GTGACTTTTCAGTTACCACCAGG + Intergenic
1072299850 10:94049396-94049418 GTGACATGTCAGATTAGAGCTGG - Intronic
1078658994 11:13269815-13269837 GTGAATTTCCAGTTTCAAGATGG - Intergenic
1078893789 11:15580230-15580252 GTGACTTATCAGGTTCACACAGG - Intergenic
1079026435 11:16951708-16951730 GTAACTTGTCAGTTTTAATCAGG + Intronic
1080305159 11:30827516-30827538 GGGAGTTGTCAGTATCAAGATGG - Intergenic
1080587569 11:33695480-33695502 GTGACTTGCCAGTTTCCACCTGG + Intergenic
1080885477 11:36363721-36363743 GTGCCTTGCCAGTGTCAGGCAGG - Intronic
1086037597 11:82435772-82435794 GACACTTGTCATTTTCAAGAAGG + Intergenic
1089078283 11:115756464-115756486 CTGCCTTCTCAGTTTCAACCTGG + Intergenic
1090149061 11:124362703-124362725 GTCATTTGTCACTTTCAAGGAGG - Intergenic
1096594106 12:52683675-52683697 GTGGCTTGTCAGTTACCTGCTGG - Intergenic
1099612998 12:84898978-84899000 GTGATCTGTCAGTTCCAAGAAGG + Intronic
1100640427 12:96477175-96477197 GTGCCTTGTAAGTTTTAAGATGG + Intergenic
1102760302 12:115379438-115379460 GTGGCTTGTCTGTTTCCACCAGG - Intergenic
1105429663 13:20325579-20325601 GTGCCTTGTTAGTTTCAAGATGG + Intergenic
1105740773 13:23321012-23321034 GTGACTTGTTATTTTCAAGTCGG + Intronic
1106660825 13:31798144-31798166 TTGACTCCTCAGTGTCAAGCAGG + Intronic
1106998902 13:35521623-35521645 GTGACTTTTGGGTTTCTAGCGGG - Intronic
1107409641 13:40146688-40146710 GTGAGTTGTCAGCTTCAAGCAGG - Intergenic
1109584969 13:64387845-64387867 GAAATTTGTCAGTTTTAAGCTGG + Intergenic
1111236856 13:85420236-85420258 GTTACTTTTCAGTTTCCATCTGG + Intergenic
1112850034 13:103694709-103694731 GTGACATGTCAGTCTCTAGCAGG - Intergenic
1114456183 14:22855099-22855121 GTGACTCATCAGTTTCAGGATGG - Intergenic
1124499740 15:30216846-30216868 GTGCCTTGTCAGCTCCACGCAGG - Intergenic
1124743839 15:32321821-32321843 GTGCCTTGTCAGCTCCACGCAGG + Intergenic
1127113183 15:55696792-55696814 CAGAGTTGTCAGATTCAAGCAGG - Intronic
1129865953 15:78908898-78908920 GTGACTTGCCAGCCTCAGGCTGG + Intergenic
1131950565 15:97676668-97676690 GTACCTTGTCAGTTTTAAGATGG + Intergenic
1131961298 15:97792593-97792615 GTGACTTGTCAGCGTCAAAGAGG + Intergenic
1133677079 16:8083827-8083849 TTGACTGGTCATTTTCAAGATGG + Intergenic
1135676462 16:24418992-24419014 GTGTCTTGTCAGTATCTAGGAGG - Intergenic
1135801582 16:25502098-25502120 GTGAACTGTCAGTTTCAAGAAGG - Intergenic
1137666437 16:50252255-50252277 GGGACTTGTCAGTGTTGAGCAGG + Intronic
1137843762 16:51666834-51666856 GTGACTTGTCATTTAAGAGCAGG + Intergenic
1139159028 16:64480644-64480666 GTGCCTTGCCAGTTTTAAGATGG + Intergenic
1140291991 16:73668050-73668072 GTGACTTATCATTTTCAAGAAGG - Intergenic
1142921513 17:3191152-3191174 GTGCCTTGTTAGTTTCAAGATGG - Intergenic
1144017014 17:11205879-11205901 GTGACTTGTCAGTATCTGGGAGG + Intergenic
1148024130 17:44573935-44573957 TTAACTTGTCAGTTTGGAGCTGG - Intergenic
1148894327 17:50831265-50831287 GTGATTAGTCAGACTCAAGCCGG - Intergenic
1149593646 17:57850186-57850208 GTTACTTGCCAGGTTCAGGCAGG + Intergenic
1151197536 17:72442339-72442361 ATGGCTTGTAAGTTTCTAGCTGG + Intergenic
1159216090 18:65392600-65392622 ACAACATGTCAGTTTCAAGCTGG - Intergenic
1165881313 19:39045967-39045989 GGGAGTTGTAAGTTTCAGGCAGG + Intergenic
1167553175 19:50175151-50175173 GTGCCTTGTCAGTCCCAAGATGG + Intergenic
1167981369 19:53278987-53279009 GTGCCTTGCTAGTTTCAAGAAGG + Intergenic
927513166 2:23657126-23657148 GTGCCTTGTCAGAGACAAGCAGG - Intronic
929549521 2:42880510-42880532 CTGACTTTTCAGTTCCAAACCGG - Intergenic
930535022 2:52635222-52635244 CTGTATTGTCAGTTTCAAGTTGG + Intergenic
931914971 2:66944106-66944128 TTGAGTTGTCATTTTCCAGCTGG - Intergenic
932117636 2:69067747-69067769 GTGAGTTGCCAGTTTCATGAGGG - Intronic
932124925 2:69136202-69136224 GTGACTGATCAGTTTCATTCAGG - Intronic
932744814 2:74325238-74325260 GTCATTTGTCAGTGACAAGCAGG - Intronic
933164932 2:79065475-79065497 GGGAGTTGTCAGCTTGAAGCTGG - Intergenic
934106031 2:88695250-88695272 CTGACTTGACAGCTTCAAGTTGG - Intronic
939636864 2:144592661-144592683 TTGCCTTGCCAGTCTCAAGCTGG + Intergenic
940300513 2:152172321-152172343 GTGACTTGTCAAATGGAAGCAGG - Intronic
940718777 2:157258646-157258668 GGGACGTGTCAGTTTAAAACAGG + Exonic
940968562 2:159868880-159868902 CTGACATGTAAGTTTCAAGCAGG - Intronic
942578317 2:177389918-177389940 GTGACTCGTCACTTTGAATCTGG - Intronic
942925385 2:181425953-181425975 GTGACTTGAGAGATTCAAGTGGG - Intergenic
944414152 2:199466907-199466929 GTGATTTGTCTGTTTATAGCAGG + Intronic
946105134 2:217362520-217362542 GTGACTTGTCTGTGTAGAGCTGG - Intronic
947392165 2:229650746-229650768 GTGCATTGTCATTTCCAAGCTGG + Intronic
1170809030 20:19659145-19659167 GTGAATTTGGAGTTTCAAGCTGG - Intronic
1171006924 20:21475429-21475451 ATGATTTGTCATCTTCAAGCTGG + Intergenic
1171197304 20:23210032-23210054 CTGCATTTTCAGTTTCAAGCAGG + Intergenic
1171211133 20:23317777-23317799 TTGAGTTCTCACTTTCAAGCAGG - Intergenic
1177228768 21:18291957-18291979 GTGTCTTGTTAGTCTCAAGATGG - Intronic
1179366226 21:40760591-40760613 CTGCTTTGCCAGTTTCAAGCAGG + Intronic
1184439483 22:44500117-44500139 CTGCATGGTCAGTTTCAAGCTGG + Intergenic
952701372 3:36331742-36331764 GTAACTTGCCAGTTTCCAGTTGG + Intergenic
953102901 3:39847217-39847239 GTGAGTTTTCAGTTGCATGCAGG - Intronic
955654485 3:61230109-61230131 GTGTCTTGGCATTTTCAAGTTGG - Intronic
955951236 3:64244337-64244359 GTGTCTTGTCATTTTCAGGGAGG + Intronic
956527763 3:70183679-70183701 ATGACTAGCTAGTTTCAAGCTGG - Intergenic
957116567 3:76034401-76034423 GTGACTTGTCTATTTCACACGGG - Intronic
959028403 3:101269237-101269259 GTAACTTGTCAGCAGCAAGCTGG + Intronic
959477256 3:106826032-106826054 GTGACTGGGCAATTTAAAGCAGG + Intergenic
961814291 3:129540847-129540869 GTGAATTGTGGGATTCAAGCGGG + Intergenic
971170941 4:24231803-24231825 ATGTCTTGTCAGTTTCACTCTGG - Intergenic
971344603 4:25800386-25800408 GTGACTTTTCAGCTGCAAGACGG + Intronic
974770456 4:66404840-66404862 ATGACCCGTCAGTTGCAAGCTGG - Intergenic
975300359 4:72783102-72783124 GTGCCTTGTTAGTCTCAAGATGG + Intergenic
978384982 4:108169246-108169268 GTTTCTTGTCAGTTTCACGCGGG - Intergenic
979554957 4:122035062-122035084 GGGACTTTTCAGTTTTAAACTGG + Intergenic
980014136 4:127629603-127629625 GTGACTTGCCAGTTTCAGGCAGG - Intronic
983371834 4:166869930-166869952 GGAGCTTCTCAGTTTCAAGCTGG - Intronic
986630605 5:9768401-9768423 GTGAGTTGACAGTTTCATGAAGG - Intergenic
992815795 5:80436116-80436138 GAGACTTGTCAGTGTGAATCTGG - Intronic
994648092 5:102494826-102494848 GTAATTTGGCAGTTTCTAGCAGG + Intronic
995761954 5:115572360-115572382 GTGATTTGTGAGTTTCAGGGTGG - Intergenic
998249642 5:140543310-140543332 GTGATTTGTCATTTGCAAACAGG + Intronic
1002007338 5:176246318-176246340 GTGAGTTGTCAGTATCAAAATGG - Intronic
1002219040 5:177664299-177664321 GTGAGTTGTCAGTATCAAAATGG + Intergenic
1004561174 6:16752480-16752502 CTGTCTTCACAGTTTCAAGCAGG + Intronic
1008480890 6:51983452-51983474 GTGTTTTGTCTGTTTGAAGCAGG - Intronic
1009708852 6:67291215-67291237 GTCACTTGTGAGGTTGAAGCAGG + Intergenic
1010028982 6:71253159-71253181 GTGAATTGACAGTTCCATGCTGG + Intergenic
1011791088 6:90899831-90899853 GTGACTTGGGAGATACAAGCTGG + Intergenic
1012669490 6:102024207-102024229 GTGACTTGTCAGTTTCAAGCTGG + Intronic
1014426443 6:121312547-121312569 GTGCCTTGTTAGTCTCAAGTTGG - Intronic
1015187505 6:130434975-130434997 GTGTTTTGTGAATTTCAAGCTGG + Intronic
1016833907 6:148458033-148458055 GTCACATGTCAGTTACATGCAGG - Intronic
1018204375 6:161423583-161423605 ATGACTTGTCAATCCCAAGCTGG + Intronic
1021027518 7:15687025-15687047 GTGACTTGTCAGTGTCATTTGGG + Intergenic
1021151716 7:17159444-17159466 GTGACTTTTTAGTTACAAGTAGG - Intergenic
1023648818 7:42347381-42347403 GTGATTTATCAGAATCAAGCTGG - Intergenic
1024954702 7:54905080-54905102 GTGACTTGCTAGTTTTAAGATGG - Intergenic
1029173737 7:98648803-98648825 GTGCCTTGTTAGTCTCAAGATGG - Intergenic
1029534980 7:101152190-101152212 GTGCCTTGTTAGTTTCAAGATGG - Intergenic
1032109075 7:129059963-129059985 GCGAGTTGTCAGTTTCTAGTTGG + Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1037771186 8:21801064-21801086 ATGAGTTGTCAGATTCCAGCAGG - Intronic
1037771306 8:21801715-21801737 GTGAGTTGTCAGATTCCAGCAGG - Intronic
1038156683 8:24998163-24998185 GTCACTTGTCAGTGTTAAGGAGG - Intergenic
1038471147 8:27822196-27822218 GTTACTTGTCAGTTCCAAAAAGG - Intronic
1038676932 8:29631411-29631433 GGGAGTTGTCAGTTTCCTGCTGG + Intergenic
1044556376 8:93566678-93566700 GTCACTTTTGAGTTTCTAGCAGG + Intergenic
1047454230 8:124994511-124994533 GTGCCTTGTTAGTCTCAAGATGG - Intergenic
1047761602 8:127958710-127958732 GTGACTTGACAGCTGCAATCTGG + Intergenic
1052014571 9:23450025-23450047 GTGACTTGTAAGAGTTAAGCTGG - Intergenic
1052799426 9:32953936-32953958 GTGCCTTGCTAGTTTCAAGATGG + Intergenic
1055352711 9:75405727-75405749 GTAACTTGTCACTTTCAGGCAGG + Intergenic
1056144033 9:83711557-83711579 GTGACTGGAAATTTTCAAGCAGG - Intergenic
1057240776 9:93406647-93406669 GTGCCTTGCCAGTTTTAAGATGG + Intergenic
1057531899 9:95856348-95856370 GTTACTTGTCCCTTTCAAGATGG + Intergenic
1058015793 9:100030774-100030796 GTCACTTGTCAGTTGCAAAGGGG - Intronic
1061454057 9:130684329-130684351 GTGACTTGTGATTTGCACGCTGG + Intergenic
1189104964 X:38226064-38226086 GTGCCTTGTTAGTCTCAAGATGG + Intronic
1190341809 X:49303116-49303138 GTGTCTTGCGAGTTTCAAGATGG + Intergenic
1190365157 X:49686103-49686125 GTGCCTTGTTAATTTCAAGATGG - Intergenic
1191176612 X:57509176-57509198 GTGCCTTGTTAGTTTCAAGATGG - Intergenic
1191896919 X:66002533-66002555 CTGACTGGGCAGTATCAAGCTGG - Intergenic
1196412546 X:115435062-115435084 GTGCCTTGTTAGTCTCAAGATGG - Intergenic
1196812758 X:119641752-119641774 GTGACTTAGCACTTACAAGCTGG - Intronic
1200233875 X:154459057-154459079 GAAACTTTGCAGTTTCAAGCTGG + Intronic