ID: 1012672950

View in Genome Browser
Species Human (GRCh38)
Location 6:102078818-102078840
Sequence TTTTCTATCGATCACTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012672950_1012672952 8 Left 1012672950 6:102078818-102078840 CCCAGAGAGTGATCGATAGAAAA No data
Right 1012672952 6:102078849-102078871 AGCCCTTAATGCCCTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012672950 Original CRISPR TTTTCTATCGATCACTCTCT GGG (reversed) Intergenic
No off target data available for this crispr