ID: 1012672952

View in Genome Browser
Species Human (GRCh38)
Location 6:102078849-102078871
Sequence AGCCCTTAATGCCCTACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012672949_1012672952 16 Left 1012672949 6:102078810-102078832 CCATGTTACCCAGAGAGTGATCG No data
Right 1012672952 6:102078849-102078871 AGCCCTTAATGCCCTACAGATGG No data
1012672950_1012672952 8 Left 1012672950 6:102078818-102078840 CCCAGAGAGTGATCGATAGAAAA No data
Right 1012672952 6:102078849-102078871 AGCCCTTAATGCCCTACAGATGG No data
1012672951_1012672952 7 Left 1012672951 6:102078819-102078841 CCAGAGAGTGATCGATAGAAAAT No data
Right 1012672952 6:102078849-102078871 AGCCCTTAATGCCCTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012672952 Original CRISPR AGCCCTTAATGCCCTACAGA TGG Intergenic
No off target data available for this crispr