ID: 1012680086

View in Genome Browser
Species Human (GRCh38)
Location 6:102169259-102169281
Sequence CAGTGAAAACACAGGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012680081_1012680086 16 Left 1012680081 6:102169220-102169242 CCAAACACAGCATGTTCTCACTC 0: 146
1: 11617
2: 18501
3: 10829
4: 8710
Right 1012680086 6:102169259-102169281 CAGTGAAAACACAGGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012680086 Original CRISPR CAGTGAAAACACAGGGACAC AGG Intergenic
No off target data available for this crispr