ID: 1012684100

View in Genome Browser
Species Human (GRCh38)
Location 6:102221779-102221801
Sequence CAGTAGCCATTAGCTACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012684098_1012684100 17 Left 1012684098 6:102221739-102221761 CCACTAAGATGGAAATTTTTTAT No data
Right 1012684100 6:102221779-102221801 CAGTAGCCATTAGCTACACTTGG No data
1012684096_1012684100 29 Left 1012684096 6:102221727-102221749 CCACAGAATTATCCACTAAGATG No data
Right 1012684100 6:102221779-102221801 CAGTAGCCATTAGCTACACTTGG No data
1012684095_1012684100 30 Left 1012684095 6:102221726-102221748 CCCACAGAATTATCCACTAAGAT No data
Right 1012684100 6:102221779-102221801 CAGTAGCCATTAGCTACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012684100 Original CRISPR CAGTAGCCATTAGCTACACT TGG Intergenic
No off target data available for this crispr