ID: 1012690138

View in Genome Browser
Species Human (GRCh38)
Location 6:102300088-102300110
Sequence CAGTAGGGCTTCAGGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012690138_1012690146 11 Left 1012690138 6:102300088-102300110 CCCACATCCCTGAAGCCCTACTG No data
Right 1012690146 6:102300122-102300144 GTACATTTGAAAGGCTGCAGTGG No data
1012690138_1012690145 2 Left 1012690138 6:102300088-102300110 CCCACATCCCTGAAGCCCTACTG No data
Right 1012690145 6:102300113-102300135 ATCTTTCAGGTACATTTGAAAGG No data
1012690138_1012690147 19 Left 1012690138 6:102300088-102300110 CCCACATCCCTGAAGCCCTACTG No data
Right 1012690147 6:102300130-102300152 GAAAGGCTGCAGTGGCGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012690138 Original CRISPR CAGTAGGGCTTCAGGGATGT GGG (reversed) Intergenic
No off target data available for this crispr