ID: 1012691479

View in Genome Browser
Species Human (GRCh38)
Location 6:102318753-102318775
Sequence GGTCCCAGAAGAACAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012691479_1012691487 11 Left 1012691479 6:102318753-102318775 CCAGCTTTTGTTCTTCTGGGACC No data
Right 1012691487 6:102318787-102318809 TATCAGTTTGACCTCTGTGGGGG No data
1012691479_1012691489 17 Left 1012691479 6:102318753-102318775 CCAGCTTTTGTTCTTCTGGGACC No data
Right 1012691489 6:102318793-102318815 TTTGACCTCTGTGGGGGTGGTGG No data
1012691479_1012691484 8 Left 1012691479 6:102318753-102318775 CCAGCTTTTGTTCTTCTGGGACC No data
Right 1012691484 6:102318784-102318806 CTATATCAGTTTGACCTCTGTGG No data
1012691479_1012691486 10 Left 1012691479 6:102318753-102318775 CCAGCTTTTGTTCTTCTGGGACC No data
Right 1012691486 6:102318786-102318808 ATATCAGTTTGACCTCTGTGGGG No data
1012691479_1012691485 9 Left 1012691479 6:102318753-102318775 CCAGCTTTTGTTCTTCTGGGACC No data
Right 1012691485 6:102318785-102318807 TATATCAGTTTGACCTCTGTGGG No data
1012691479_1012691488 14 Left 1012691479 6:102318753-102318775 CCAGCTTTTGTTCTTCTGGGACC No data
Right 1012691488 6:102318790-102318812 CAGTTTGACCTCTGTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012691479 Original CRISPR GGTCCCAGAAGAACAAAAGC TGG (reversed) Intergenic
No off target data available for this crispr