ID: 1012691484

View in Genome Browser
Species Human (GRCh38)
Location 6:102318784-102318806
Sequence CTATATCAGTTTGACCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012691479_1012691484 8 Left 1012691479 6:102318753-102318775 CCAGCTTTTGTTCTTCTGGGACC No data
Right 1012691484 6:102318784-102318806 CTATATCAGTTTGACCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012691484 Original CRISPR CTATATCAGTTTGACCTCTG TGG Intergenic
No off target data available for this crispr