ID: 1012691489

View in Genome Browser
Species Human (GRCh38)
Location 6:102318793-102318815
Sequence TTTGACCTCTGTGGGGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012691479_1012691489 17 Left 1012691479 6:102318753-102318775 CCAGCTTTTGTTCTTCTGGGACC No data
Right 1012691489 6:102318793-102318815 TTTGACCTCTGTGGGGGTGGTGG No data
1012691482_1012691489 -4 Left 1012691482 6:102318774-102318796 CCCTGGGACACTATATCAGTTTG No data
Right 1012691489 6:102318793-102318815 TTTGACCTCTGTGGGGGTGGTGG No data
1012691483_1012691489 -5 Left 1012691483 6:102318775-102318797 CCTGGGACACTATATCAGTTTGA No data
Right 1012691489 6:102318793-102318815 TTTGACCTCTGTGGGGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012691489 Original CRISPR TTTGACCTCTGTGGGGGTGG TGG Intergenic
No off target data available for this crispr