ID: 1012692589

View in Genome Browser
Species Human (GRCh38)
Location 6:102333877-102333899
Sequence GAGTTGTGATGAGCCCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012692585_1012692589 14 Left 1012692585 6:102333840-102333862 CCTTGTGTGAGGAGAACACAGGG No data
Right 1012692589 6:102333877-102333899 GAGTTGTGATGAGCCCTTCTGGG No data
1012692582_1012692589 16 Left 1012692582 6:102333838-102333860 CCCCTTGTGTGAGGAGAACACAG No data
Right 1012692589 6:102333877-102333899 GAGTTGTGATGAGCCCTTCTGGG No data
1012692583_1012692589 15 Left 1012692583 6:102333839-102333861 CCCTTGTGTGAGGAGAACACAGG No data
Right 1012692589 6:102333877-102333899 GAGTTGTGATGAGCCCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012692589 Original CRISPR GAGTTGTGATGAGCCCTTCT GGG Intergenic
No off target data available for this crispr