ID: 1012696684

View in Genome Browser
Species Human (GRCh38)
Location 6:102392500-102392522
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012696684_1012696686 22 Left 1012696684 6:102392500-102392522 CCTTAATACACCAAGAATCATAT No data
Right 1012696686 6:102392545-102392567 ATTAAAATCAGATCCTTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012696684 Original CRISPR ATATGATTCTTGGTGTATTA AGG (reversed) Intergenic
No off target data available for this crispr