ID: 1012703962

View in Genome Browser
Species Human (GRCh38)
Location 6:102497796-102497818
Sequence AGTACTATCCAGAATCTACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012703962_1012703965 24 Left 1012703962 6:102497796-102497818 CCTCGTAGATTCTGGATAGTACT No data
Right 1012703965 6:102497843-102497865 AATATTTCCTCCTGTTATGTGGG No data
1012703962_1012703964 23 Left 1012703962 6:102497796-102497818 CCTCGTAGATTCTGGATAGTACT No data
Right 1012703964 6:102497842-102497864 GAATATTTCCTCCTGTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012703962 Original CRISPR AGTACTATCCAGAATCTACG AGG (reversed) Intergenic
No off target data available for this crispr