ID: 1012704711

View in Genome Browser
Species Human (GRCh38)
Location 6:102507685-102507707
Sequence AAAGATTTACTGAAACTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012704711_1012704712 28 Left 1012704711 6:102507685-102507707 CCTCTGAGTTTCAGTAAATCTTT No data
Right 1012704712 6:102507736-102507758 TAATAACATCAATATAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012704711 Original CRISPR AAAGATTTACTGAAACTCAG AGG (reversed) Intergenic
No off target data available for this crispr