ID: 1012709678

View in Genome Browser
Species Human (GRCh38)
Location 6:102582799-102582821
Sequence GCGCCTGGCTCGCTATTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012709673_1012709678 14 Left 1012709673 6:102582762-102582784 CCTTGCACTCCTTGGCTCAGACA No data
Right 1012709678 6:102582799-102582821 GCGCCTGGCTCGCTATTGGCAGG No data
1012709671_1012709678 23 Left 1012709671 6:102582753-102582775 CCTTGCAGACCTTGCACTCCTTG No data
Right 1012709678 6:102582799-102582821 GCGCCTGGCTCGCTATTGGCAGG No data
1012709674_1012709678 5 Left 1012709674 6:102582771-102582793 CCTTGGCTCAGACACTCCTTGCT No data
Right 1012709678 6:102582799-102582821 GCGCCTGGCTCGCTATTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012709678 Original CRISPR GCGCCTGGCTCGCTATTGGC AGG Intergenic
No off target data available for this crispr