ID: 1012710077

View in Genome Browser
Species Human (GRCh38)
Location 6:102588326-102588348
Sequence AGTATGTACGTGTGTATACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012710076_1012710077 -6 Left 1012710076 6:102588309-102588331 CCATATATATTTTTTAAAGTATG No data
Right 1012710077 6:102588326-102588348 AGTATGTACGTGTGTATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012710077 Original CRISPR AGTATGTACGTGTGTATACA TGG Intergenic
No off target data available for this crispr