ID: 1012713184 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:102634369-102634391 |
| Sequence | AAGAAGAAGAAGAAGAAGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 9499 | |||
| Summary | {0: 10, 1: 198, 2: 474, 3: 1669, 4: 7148} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1012713182_1012713184 | 6 | Left | 1012713182 | 6:102634340-102634362 | CCTAGAGTAAAATGACTGGTTAT | 0: 5 1: 35 2: 135 3: 201 4: 406 |
||
| Right | 1012713184 | 6:102634369-102634391 | AAGAAGAAGAAGAAGAAGGAAGG | 0: 10 1: 198 2: 474 3: 1669 4: 7148 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1012713184 | Original CRISPR | AAGAAGAAGAAGAAGAAGGA AGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||