ID: 1012713184

View in Genome Browser
Species Human (GRCh38)
Location 6:102634369-102634391
Sequence AAGAAGAAGAAGAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9499
Summary {0: 10, 1: 198, 2: 474, 3: 1669, 4: 7148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012713182_1012713184 6 Left 1012713182 6:102634340-102634362 CCTAGAGTAAAATGACTGGTTAT 0: 5
1: 35
2: 135
3: 201
4: 406
Right 1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG 0: 10
1: 198
2: 474
3: 1669
4: 7148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012713184 Original CRISPR AAGAAGAAGAAGAAGAAGGA AGG Intergenic
Too many off-targets to display for this crispr