ID: 1012716136

View in Genome Browser
Species Human (GRCh38)
Location 6:102672990-102673012
Sequence CTGGTTAAGCTCCACCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012716129_1012716136 15 Left 1012716129 6:102672952-102672974 CCCTTATCAGTCAAGTGTTCCCA No data
Right 1012716136 6:102672990-102673012 CTGGTTAAGCTCCACCATTTTGG No data
1012716128_1012716136 22 Left 1012716128 6:102672945-102672967 CCTTTTTCCCTTATCAGTCAAGT No data
Right 1012716136 6:102672990-102673012 CTGGTTAAGCTCCACCATTTTGG No data
1012716130_1012716136 14 Left 1012716130 6:102672953-102672975 CCTTATCAGTCAAGTGTTCCCAG No data
Right 1012716136 6:102672990-102673012 CTGGTTAAGCTCCACCATTTTGG No data
1012716135_1012716136 -5 Left 1012716135 6:102672972-102672994 CCAGAGGAAGGTCATATACTGGT No data
Right 1012716136 6:102672990-102673012 CTGGTTAAGCTCCACCATTTTGG No data
1012716133_1012716136 -4 Left 1012716133 6:102672971-102672993 CCCAGAGGAAGGTCATATACTGG No data
Right 1012716136 6:102672990-102673012 CTGGTTAAGCTCCACCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012716136 Original CRISPR CTGGTTAAGCTCCACCATTT TGG Intergenic
No off target data available for this crispr