ID: 1012718731

View in Genome Browser
Species Human (GRCh38)
Location 6:102712558-102712580
Sequence GCTTCAGTGTTACATGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012718727_1012718731 10 Left 1012718727 6:102712525-102712547 CCTAAAACCCACATATATTATTC No data
Right 1012718731 6:102712558-102712580 GCTTCAGTGTTACATGGTACAGG No data
1012718729_1012718731 2 Left 1012718729 6:102712533-102712555 CCACATATATTATTCAAATTTCA No data
Right 1012718731 6:102712558-102712580 GCTTCAGTGTTACATGGTACAGG No data
1012718728_1012718731 3 Left 1012718728 6:102712532-102712554 CCCACATATATTATTCAAATTTC No data
Right 1012718731 6:102712558-102712580 GCTTCAGTGTTACATGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012718731 Original CRISPR GCTTCAGTGTTACATGGTAC AGG Intergenic
No off target data available for this crispr