ID: 1012720463

View in Genome Browser
Species Human (GRCh38)
Location 6:102736277-102736299
Sequence TGCCTTCTGGTCTACCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012720463_1012720466 15 Left 1012720463 6:102736277-102736299 CCACTAGGGTAGACCAGAAGGCA No data
Right 1012720466 6:102736315-102736337 TGCTAGAATGATTAAGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012720463 Original CRISPR TGCCTTCTGGTCTACCCTAG TGG (reversed) Intergenic
No off target data available for this crispr