ID: 1012723498

View in Genome Browser
Species Human (GRCh38)
Location 6:102779826-102779848
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012723494_1012723498 19 Left 1012723494 6:102779784-102779806 CCTGGCAGGGGTTTGGGGGTATG No data
Right 1012723498 6:102779826-102779848 GTGTTATCCCAGATTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012723498 Original CRISPR GTGTTATCCCAGATTGAGGA AGG Intergenic
No off target data available for this crispr