ID: 1012725894

View in Genome Browser
Species Human (GRCh38)
Location 6:102809355-102809377
Sequence GACTTCCGTTGGCTAAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012725889_1012725894 4 Left 1012725889 6:102809328-102809350 CCCAATTTTTCAGGTACCATCTG No data
Right 1012725894 6:102809355-102809377 GACTTCCGTTGGCTAAGAAAGGG No data
1012725890_1012725894 3 Left 1012725890 6:102809329-102809351 CCAATTTTTCAGGTACCATCTGT No data
Right 1012725894 6:102809355-102809377 GACTTCCGTTGGCTAAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012725894 Original CRISPR GACTTCCGTTGGCTAAGAAA GGG Intergenic
No off target data available for this crispr