ID: 1012727740

View in Genome Browser
Species Human (GRCh38)
Location 6:102837688-102837710
Sequence TTGGCTAATGGCCCTAATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012727740_1012727746 9 Left 1012727740 6:102837688-102837710 CCAACATTAGGGCCATTAGCCAA No data
Right 1012727746 6:102837720-102837742 TGATACATCTGGAAAATTCTGGG No data
1012727740_1012727745 8 Left 1012727740 6:102837688-102837710 CCAACATTAGGGCCATTAGCCAA No data
Right 1012727745 6:102837719-102837741 CTGATACATCTGGAAAATTCTGG No data
1012727740_1012727743 -2 Left 1012727740 6:102837688-102837710 CCAACATTAGGGCCATTAGCCAA No data
Right 1012727743 6:102837709-102837731 AAAAGTTATCCTGATACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012727740 Original CRISPR TTGGCTAATGGCCCTAATGT TGG (reversed) Intergenic
No off target data available for this crispr