ID: 1012729131

View in Genome Browser
Species Human (GRCh38)
Location 6:102858064-102858086
Sequence AATAGTACAAAGAAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012729131_1012729135 4 Left 1012729131 6:102858064-102858086 CCTCCATCCTTCTTTGTACTATT No data
Right 1012729135 6:102858091-102858113 GTCTTTGGAAACACTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012729131 Original CRISPR AATAGTACAAAGAAGGATGG AGG (reversed) Intergenic
No off target data available for this crispr