ID: 1012729132

View in Genome Browser
Species Human (GRCh38)
Location 6:102858067-102858089
Sequence ATGAATAGTACAAAGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012729132_1012729135 1 Left 1012729132 6:102858067-102858089 CCATCCTTCTTTGTACTATTCAT No data
Right 1012729135 6:102858091-102858113 GTCTTTGGAAACACTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012729132 Original CRISPR ATGAATAGTACAAAGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr