ID: 1012729135

View in Genome Browser
Species Human (GRCh38)
Location 6:102858091-102858113
Sequence GTCTTTGGAAACACTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012729131_1012729135 4 Left 1012729131 6:102858064-102858086 CCTCCATCCTTCTTTGTACTATT No data
Right 1012729135 6:102858091-102858113 GTCTTTGGAAACACTCTCACAGG No data
1012729133_1012729135 -3 Left 1012729133 6:102858071-102858093 CCTTCTTTGTACTATTCATTGTC No data
Right 1012729135 6:102858091-102858113 GTCTTTGGAAACACTCTCACAGG No data
1012729132_1012729135 1 Left 1012729132 6:102858067-102858089 CCATCCTTCTTTGTACTATTCAT No data
Right 1012729135 6:102858091-102858113 GTCTTTGGAAACACTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012729135 Original CRISPR GTCTTTGGAAACACTCTCAC AGG Intergenic
No off target data available for this crispr