ID: 1012729532

View in Genome Browser
Species Human (GRCh38)
Location 6:102864111-102864133
Sequence AAGTACTACTAGAGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012729527_1012729532 18 Left 1012729527 6:102864070-102864092 CCTGAACATAAAGATGGCAATAA No data
Right 1012729532 6:102864111-102864133 AAGTACTACTAGAGGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012729532 Original CRISPR AAGTACTACTAGAGGGGAGA AGG Intergenic
No off target data available for this crispr