ID: 1012730458

View in Genome Browser
Species Human (GRCh38)
Location 6:102874291-102874313
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012730458_1012730460 4 Left 1012730458 6:102874291-102874313 CCTGCCATCTTCTACAGATAACT No data
Right 1012730460 6:102874318-102874340 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1012730458_1012730462 15 Left 1012730458 6:102874291-102874313 CCTGCCATCTTCTACAGATAACT No data
Right 1012730462 6:102874329-102874351 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
1012730458_1012730463 16 Left 1012730458 6:102874291-102874313 CCTGCCATCTTCTACAGATAACT No data
Right 1012730463 6:102874330-102874352 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
1012730458_1012730464 22 Left 1012730458 6:102874291-102874313 CCTGCCATCTTCTACAGATAACT No data
Right 1012730464 6:102874336-102874358 CTTGGCCTGTTACTGGGTTTTGG No data
1012730458_1012730465 25 Left 1012730458 6:102874291-102874313 CCTGCCATCTTCTACAGATAACT No data
Right 1012730465 6:102874339-102874361 GGCCTGTTACTGGGTTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012730458 Original CRISPR AGTTATCTGTAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr