ID: 1012730465

View in Genome Browser
Species Human (GRCh38)
Location 6:102874339-102874361
Sequence GGCCTGTTACTGGGTTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012730458_1012730465 25 Left 1012730458 6:102874291-102874313 CCTGCCATCTTCTACAGATAACT No data
Right 1012730465 6:102874339-102874361 GGCCTGTTACTGGGTTTTGGTGG No data
1012730461_1012730465 -3 Left 1012730461 6:102874319-102874341 CCTTTTGAGAGACAGCTCTTGGC 0: 173
1: 182
2: 165
3: 95
4: 236
Right 1012730465 6:102874339-102874361 GGCCTGTTACTGGGTTTTGGTGG No data
1012730457_1012730465 26 Left 1012730457 6:102874290-102874312 CCCTGCCATCTTCTACAGATAAC No data
Right 1012730465 6:102874339-102874361 GGCCTGTTACTGGGTTTTGGTGG No data
1012730459_1012730465 21 Left 1012730459 6:102874295-102874317 CCATCTTCTACAGATAACTACTC No data
Right 1012730465 6:102874339-102874361 GGCCTGTTACTGGGTTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012730465 Original CRISPR GGCCTGTTACTGGGTTTTGG TGG Intergenic
No off target data available for this crispr