ID: 1012731564

View in Genome Browser
Species Human (GRCh38)
Location 6:102888447-102888469
Sequence TGCCCCGGAAGTCAAAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012731561_1012731564 -10 Left 1012731561 6:102888434-102888456 CCAAGGTAAATTATGCCCCGGAA No data
Right 1012731564 6:102888447-102888469 TGCCCCGGAAGTCAAAGAAGGGG No data
1012731560_1012731564 -9 Left 1012731560 6:102888433-102888455 CCCAAGGTAAATTATGCCCCGGA No data
Right 1012731564 6:102888447-102888469 TGCCCCGGAAGTCAAAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012731564 Original CRISPR TGCCCCGGAAGTCAAAGAAG GGG Intergenic
No off target data available for this crispr