ID: 1012733545

View in Genome Browser
Species Human (GRCh38)
Location 6:102910904-102910926
Sequence GCCGGCGGGCCCGCAAGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012733545_1012733548 -9 Left 1012733545 6:102910904-102910926 CCCGGGCTTGCGGGCCCGCCGGC No data
Right 1012733548 6:102910918-102910940 CCCGCCGGCCTCTCCGAGTGCGG No data
1012733545_1012733555 15 Left 1012733545 6:102910904-102910926 CCCGGGCTTGCGGGCCCGCCGGC No data
Right 1012733555 6:102910942-102910964 CCGCCGAGCCCACGCCCACCCGG 0: 79
1: 581
2: 637
3: 391
4: 425
1012733545_1012733559 27 Left 1012733545 6:102910904-102910926 CCCGGGCTTGCGGGCCCGCCGGC No data
Right 1012733559 6:102910954-102910976 CGCCCACCCGGAACTCGCGCTGG 0: 119
1: 275
2: 784
3: 689
4: 391
1012733545_1012733550 -8 Left 1012733545 6:102910904-102910926 CCCGGGCTTGCGGGCCCGCCGGC No data
Right 1012733550 6:102910919-102910941 CCGCCGGCCTCTCCGAGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012733545 Original CRISPR GCCGGCGGGCCCGCAAGCCC GGG (reversed) Intergenic
No off target data available for this crispr