ID: 1012740477

View in Genome Browser
Species Human (GRCh38)
Location 6:103009858-103009880
Sequence ACTTCAGTCTACAAGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012740472_1012740477 17 Left 1012740472 6:103009818-103009840 CCATAGCCATGTGGAACTAGACA No data
Right 1012740477 6:103009858-103009880 ACTTCAGTCTACAAGGAAAAAGG No data
1012740471_1012740477 18 Left 1012740471 6:103009817-103009839 CCCATAGCCATGTGGAACTAGAC No data
Right 1012740477 6:103009858-103009880 ACTTCAGTCTACAAGGAAAAAGG No data
1012740473_1012740477 11 Left 1012740473 6:103009824-103009846 CCATGTGGAACTAGACAGAAATG No data
Right 1012740477 6:103009858-103009880 ACTTCAGTCTACAAGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012740477 Original CRISPR ACTTCAGTCTACAAGGAAAA AGG Intergenic
No off target data available for this crispr