ID: 1012745531

View in Genome Browser
Species Human (GRCh38)
Location 6:103082483-103082505
Sequence CAGTATTTATAGATGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012745531_1012745534 -2 Left 1012745531 6:103082483-103082505 CCCTTTTCCATCTATAAATACTG No data
Right 1012745534 6:103082504-103082526 TGTCTACCCATGTTGCTGTGTGG No data
1012745531_1012745537 19 Left 1012745531 6:103082483-103082505 CCCTTTTCCATCTATAAATACTG No data
Right 1012745537 6:103082525-103082547 GGAGCTCTCTGAACTTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012745531 Original CRISPR CAGTATTTATAGATGGAAAA GGG (reversed) Intergenic
No off target data available for this crispr