ID: 1012745534

View in Genome Browser
Species Human (GRCh38)
Location 6:103082504-103082526
Sequence TGTCTACCCATGTTGCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012745531_1012745534 -2 Left 1012745531 6:103082483-103082505 CCCTTTTCCATCTATAAATACTG No data
Right 1012745534 6:103082504-103082526 TGTCTACCCATGTTGCTGTGTGG No data
1012745530_1012745534 11 Left 1012745530 6:103082470-103082492 CCTTATGTTACTTCCCTTTTCCA No data
Right 1012745534 6:103082504-103082526 TGTCTACCCATGTTGCTGTGTGG No data
1012745532_1012745534 -3 Left 1012745532 6:103082484-103082506 CCTTTTCCATCTATAAATACTGT No data
Right 1012745534 6:103082504-103082526 TGTCTACCCATGTTGCTGTGTGG No data
1012745533_1012745534 -9 Left 1012745533 6:103082490-103082512 CCATCTATAAATACTGTCTACCC No data
Right 1012745534 6:103082504-103082526 TGTCTACCCATGTTGCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012745534 Original CRISPR TGTCTACCCATGTTGCTGTG TGG Intergenic
No off target data available for this crispr