ID: 1012745537

View in Genome Browser
Species Human (GRCh38)
Location 6:103082525-103082547
Sequence GGAGCTCTCTGAACTTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012745536_1012745537 -9 Left 1012745536 6:103082511-103082533 CCATGTTGCTGTGTGGAGCTCTC No data
Right 1012745537 6:103082525-103082547 GGAGCTCTCTGAACTTTTACTGG No data
1012745533_1012745537 12 Left 1012745533 6:103082490-103082512 CCATCTATAAATACTGTCTACCC No data
Right 1012745537 6:103082525-103082547 GGAGCTCTCTGAACTTTTACTGG No data
1012745535_1012745537 -8 Left 1012745535 6:103082510-103082532 CCCATGTTGCTGTGTGGAGCTCT No data
Right 1012745537 6:103082525-103082547 GGAGCTCTCTGAACTTTTACTGG No data
1012745531_1012745537 19 Left 1012745531 6:103082483-103082505 CCCTTTTCCATCTATAAATACTG No data
Right 1012745537 6:103082525-103082547 GGAGCTCTCTGAACTTTTACTGG No data
1012745532_1012745537 18 Left 1012745532 6:103082484-103082506 CCTTTTCCATCTATAAATACTGT No data
Right 1012745537 6:103082525-103082547 GGAGCTCTCTGAACTTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012745537 Original CRISPR GGAGCTCTCTGAACTTTTAC TGG Intergenic
No off target data available for this crispr