ID: 1012747698

View in Genome Browser
Species Human (GRCh38)
Location 6:103115684-103115706
Sequence CAGGCCCATCTCTAATTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012747698_1012747708 2 Left 1012747698 6:103115684-103115706 CCCCAAAATTAGAGATGGGCCTG No data
Right 1012747708 6:103115709-103115731 GGGAGGTGTTTGAGTCATAGGGG No data
1012747698_1012747711 25 Left 1012747698 6:103115684-103115706 CCCCAAAATTAGAGATGGGCCTG No data
Right 1012747711 6:103115732-103115754 GGCATCCCTCATGAATATCTTGG No data
1012747698_1012747706 0 Left 1012747698 6:103115684-103115706 CCCCAAAATTAGAGATGGGCCTG No data
Right 1012747706 6:103115707-103115729 GTGGGAGGTGTTTGAGTCATAGG 0: 35
1: 575
2: 2137
3: 8687
4: 12964
1012747698_1012747707 1 Left 1012747698 6:103115684-103115706 CCCCAAAATTAGAGATGGGCCTG No data
Right 1012747707 6:103115708-103115730 TGGGAGGTGTTTGAGTCATAGGG No data
1012747698_1012747709 3 Left 1012747698 6:103115684-103115706 CCCCAAAATTAGAGATGGGCCTG No data
Right 1012747709 6:103115710-103115732 GGAGGTGTTTGAGTCATAGGGGG No data
1012747698_1012747710 4 Left 1012747698 6:103115684-103115706 CCCCAAAATTAGAGATGGGCCTG No data
Right 1012747710 6:103115711-103115733 GAGGTGTTTGAGTCATAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012747698 Original CRISPR CAGGCCCATCTCTAATTTTG GGG (reversed) Intergenic
No off target data available for this crispr