ID: 1012759021

View in Genome Browser
Species Human (GRCh38)
Location 6:103273244-103273266
Sequence GCCCCCTACAGAATAACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012759020_1012759021 8 Left 1012759020 6:103273213-103273235 CCTTCAAAACTTATTTTGTTTAG No data
Right 1012759021 6:103273244-103273266 GCCCCCTACAGAATAACCAAAGG No data
1012759019_1012759021 20 Left 1012759019 6:103273201-103273223 CCTGTCAGTAGTCCTTCAAAACT No data
Right 1012759021 6:103273244-103273266 GCCCCCTACAGAATAACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012759021 Original CRISPR GCCCCCTACAGAATAACCAA AGG Intergenic
No off target data available for this crispr